Open Access

Porcine aminopeptidase N binds to F4+ enterotoxigenic Escherichia coli fimbriae

  • Pengpeng Xia1, 2,
  • Yiting Wang1, 2,
  • Congrui Zhu3,
  • Yajie Zou1, 2,
  • Ying Yang1, 2,
  • Wei Liu1, 2,
  • Philip R. Hardwidge4 and
  • Guoqiang Zhu1, 2Email author
Contributed equally
Veterinary Research201647:24

https://doi.org/10.1186/s13567-016-0313-5

Received: 3 November 2015

Accepted: 25 January 2016

Published: 9 February 2016

Abstract

F4+ enterotoxigenic Escherichia coli (ETEC) strains cause diarrheal disease in neonatal and post-weaned piglets. Several different host receptors for F4 fimbriae have been described, with porcine aminopeptidase N (APN) reported most recently. The FaeG subunit is essential for the binding of the three F4 variants to host cells. Here we show in both yeast two-hybrid and pulldown assays that APN binds directly to FaeG, the major subunit of F4 fimbriae, from three serotypes of F4+ ETEC. Modulating APN gene expression in IPEC-J2 cells affected ETEC adherence. Antibodies raised against APN or F4 fimbriae both reduced ETEC adherence. Thus, APN mediates the attachment of F4+ E. coli to intestinal epithelial cells.

Introduction

F4+ enterotoxigenic Escherichia coli (ETEC) infections cause neonatal and post-weaning diarrhea (PWD) in piglets. Interactions between F4 fimbriae and specific receptors on the host intestinal mucosa are essential to initiate attachment, colonization, and infection [1, 2]. Some breeds of pigs are resistant to F4+ ETEC infection because they lack F4 receptors (F4Rs) [3, 4].

F4 fimbriae are important ETEC virulence factors and exist as three antigenic variants, namely F4ab, F4ac, and F4ad [5]. These three F4 fimbriae are similar, but differ in the faeG gene, which encodes the major fimbrial subunit, resulting in different adhesive properties and specificities in attachment to the small intestine [6, 7]. Strains in which faeG is deleted exhibit significantly reduced adherence to host cells [8]. Oral administration of F4 fimbriae or FaeG induces a protective mucosal immune response in F4 receptor positive piglets and FaeG mediates ETEC binding to host cells [4, 6, 7]. It seems likely that the major FaeG subunit is not only an essential component of F4 fimbriae but also directly mediates the binding of F4+ E. coli [9].

Various potential host receptors for F4 fimbriae have been described, including MUC4, MUC13, MUC20, ITGB5, and TFRC [1013]. The polymorphic XbaI restriction enzyme site in intron 7 of the muc4 gene has been used as a biomarker to classify an important percentage of piglets as susceptible or resistant to F4+ ETEC infections [1416]. Mucin 4 polymorphisms and their candidate glycoprotein receptors are highly associated with the MUC4-susceptible genotype [17]. However, MUC4 genotypes are not completely associated with F4 ETEC susceptibility and there are likely to be other F4 receptors [18, 19]. Recently, porcine aminopeptidase N (APN) was reported to serve as a receptor protein for F4ac+ ETEC [20]. APN, also known as ANPEP and PEPN, is a Zn2+ membrane-bound exopeptidase that is highly expressed on the intestinal mucosa [21]. APN can promote intestinal epithelial cell endocytosis in F4Rs piglets and is involved in the induction of mucosal immunity [20]. Here we desired to characterize the interaction between APN and FaeG, to investigate whether modulating APN expression in IPEC-J2 cells could affect ETEC adherence, and to determine whether APN is directly involved in the adherence of F4+ ETEC to host cells.

Materials and methods

Bacterial strains, antibodies, cell lines, and culture conditions

F4+ E. coli (C83901, O8:K87:F4ab; C83902, O8:K87:F4ac; C83903, O141:K85:F4ad) strains and their respective faeG deletion mutants were cultivated in Luria–Bertani (LB) media [8, 22]. Recombinant E. coli SE5000 strains carrying the fae operon gene clusters, designated as rF4ab, rF4ac, and rF4ad, respectively, were cultivated in LB medium supplemented with ampicillin (100 μg/mL) [23]. Bacteria harboring the pcDNATM6.2-GW/miR-APN-top10 plasmid were cultivated in SOB medium supplemented with 50 µg/mL spectinomycin. All broth cultures were grown with agitation (178 rpm) at 37 °C.

Porcine neonatal jejunal IPEC-J2 cells were grown in RPMI 1640-F12 (1:1) (Gibco) supplemented with 10% fetal bovine serum (FBS, Gibco) at 37 °C in a humidified incubator in an atmosphere of 6% CO2. The monoclonal anti-F4 antibody was developed in our lab [24].

apn gene cloning and expression

Total RNA was extracted from jejunum samples of 10-day-old piglets using TRIzol reagent [25]. Reverse transcription polymerase chain reaction (RT-PCR) was performed using Superscript 18080 reverse transcriptase (Invitrogen) with primers (APN-Up1: CGGGGATCCATGGCCAAGGGATTCTAC; APN-Lo1: CCCGCTCGAGTATTAGCTGTGCTCTATG) specific to the porcine APN mRNA (GenBank: NM_214277). PCR products were cloned into pET-28a (+) and transformed into E. coli BL21 (DE3) (Novagen) for recombinant expression of APN [26]. The recombinant protein was purified and used to immunize 6-week-old BALB/c female mice to produce polyclonal antiserum specific for APN [27].

Protein–protein interaction assays

Agglutination assays were conducted as described previously [28]. F4+ E. coli were cultured overnight at 37 °C, diluted with two volumes of PBS after centrifugation, and washed twice with PBS. Bacterial suspensions (10 µL) were applied to glass slides and mixed with APN protein. Visible agglutination within 2 min incubation was considered as positive.

For yeast two-hybrid assays (Y2H, Clontech) [29], pGADT7-FaeG and pGBKT7-APN were constructed and transformed into Saccharomyces cerevisiae strain AH109 (Clontech). Positive clones were selected on SD/-Ade/-His/-Leu/-Trp medium and tested for β-galactosidase activity. Yeast transformed with pGBKT7-p53 and pGADT7-T (Clontech) served as a positive control and yeast transformed with pGBKT7-Lam and pGADT7-T (Clontech) served as a negative control.

For pull-down assays, pGEX-6p-1-FaeG F4ab, pGEX-6p-1-FaeG F4ac, and pGEX-6p-1-FaeG F4ad were constructed. These GST-FaeG fusion bait protein expression were induced with 1 mM IPTG at 16 °C for 16 h. GST-APN was loaded on a Pierce™ GST Protein Interaction Pull-Down Kit (Thermo) according to the manufacturer’s instructions [30]. SDS-PAGE and Western blotting were performed to determine whether APN and FaeG interact in vitro. The blots were incubated overnight with either monoclonal antibodies against F4+ fimbriae or polyclonal antibodies against APN, and stained using enhanced chemiluminescence (ECL) (Pierce) reagents.

To investigate the role of glycans in the APN-FaeG interaction, in some cases, PDVF membranes were treated with 0–20 mM NaIO4 (Sigma-Aldrich) in 50 mM sodium acetate, pH 4.5, at 37 °C in the dark for 30 min–2 h [20, 31, 32]. Membranes were thoroughly with TBST, blocked with a 2% BSA, and then used in Western blotting experiments as described above.

apn knockdown and overexpression cell lines

The apn gene was amplified using PCR (APN-Up2 primer: CCCGCTCGAGGAGAAGAACAAGAATGCC; APN-Lo2 primer: GGGCGGATCCTGCTGTGCTCTATGAACCA) (underlined XhoI and BamHI restriction sites) and then cloned into the pEC129 vector. The woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) was excised from pEC107 and cloned into the NotI site of pEC128) [33]. The resultant plasmid was transfected into IPEC-J2 cells using Lipofectamine 2000 Reagent (Invitrogen). G418 (400 μg/mL) was used to select for cells that stably expressed APN [34, 35]. For apn gene knockdown experiments, apn gene fragments were cloned into the pcDNA™6.2-GW/miR expression vector (Invitrogen) [36]. The resultant pcDNA™6.2-GW/miR-APN plasmid was transfected into IPEC-J2 cells and established cell lines of pcDNA™6.2-GW/miR- apn were screened and selected using Blasticidin S Hydrochloride (Blasticidin S HCl, 4 µg/mL).

Real-time RT-PCR

Total RNA was extracted from IPEC-J2 cells using TRIzol [25]. cDNA was synthesized using PrimeScript™ 1st strand cDNA Synthesis Kit for Perfect Real Time (Takara). Primers (APN-Up3: ATCGACAGGACTGAGCTGGT; APN-Lo3: CAAAGCATGGGAAGGATTTC) were targeted to conserved apn sequences. RT-PCR reactions were performed in triplicate, data were normalized to the endogenous reference gene GAPDH (Up1: TGGTGAAGGTCGGAGTGAAC; Lo1: GGAAGATGGTGATGGGATTTC), and analyzed using the 2−ΔΔCT method [37].

Western blotting

Proteins were harvested in RIPA buffer with PMSF and incubated overnight with polyclonal antibodies against APN. Blots were developed using enhanced chemiluminescence (ECL) (Pierce) reagents.

Adhesion and inhibition assays

In vitro adhesion assays were performed as previously described [25, 38]. Bacteria (1 × 107 CFUs) were added to a monolayer of about 1 × 105 cells in each well of a 96-well culture plate (Corning, NY, USA) for 1 h at 37 °C (6% CO2). Cell monolayer were washed gently three times with PBS and then 0.5% Triton X-100 was added for 20 min. Lysates were serially diluted and spread on LB agar to enumerate adherent bacteria. The experiments were repeated three times.

Both the anti-F4 fimbriae monoclonal antibody and the anti-APN polyclonal antiserum were used for in vitro inhibition assays. Anti-APN polyclonal antiserum at 1:1, 1:10, and 1:100 dilutions was co-incubated with a monolayer of about 1 × 105 IPEC-J2 cells in each well of a 96-well culture plate for 2 h at 37 °C before adding bacteria. The monoclonal antiserum against F4 fimbriae (1:100 dilution) was co-incubated with bacterial suspensions for 30 min at 37 °C (6% CO2) with gentle agitation prior to their addition onto the IPEC-J2 cell monolayer. Lysates were serially diluted and spread on LB agar to enumerate adherent bacteria. The experiments were repeated three times.

Statistical analyses

All analyses were performed using SPSS 16.0 software (SPSS Inc., USA) using t tests. A p value of less than 0.05 was considered statistically significant.

Results

APN interacts with both F4+ fimbriae and with FaeG

We first used agglutination assays to test for interactions between APN and F4+ E. coli. Recombinant strains expressing F4 fimbriae had the strongest agglutination, while ΔfaeG mutants exhibited weak agglutination with APN. Compared with F4ad bacteria, the groups of F4ab and F4ac have a more visible reaction but the difference among three serotypes are not significant (Table 1). Both yeast two-hybrid and pulldown assays were used to determine whether the APN protein binds directly to FaeG. The positive β-galactosidase activities from yeast two-hybrid experiments showed that APN interacted with FaeG when co-expressed in yeast (Figure 1A) and the pulldown results with purified APN and FaeG also demonstrated that APN binds directly to FaeG in vitro (Figure 1B). Treating PDVF membranes to which APN/FaeG pulldown samples had been transferred with metaperiodate (NaIO4) did not have significant impact to the results of the APN-FaeG pulldown (Figure 1C).
Table 1

Agglutination assay results between APN and F4 + E. coli

Bacterial Strain

Agglutination with APNa

F4ab

+++

rF4ab

++++

F4abΔfaeG

+/−

F4ac

+++

rF4ac

++++

F4acΔfaeG

+/−

F4ad

++

rF4ad

+++

F4adΔfaeG

+/−

SE5000

DH5α

a++++ = nearly 100% agglutination; +++ = turbid background with intermediate agglutination; ++ = obvious but not strong agglutination; +/− = insignificant agglutination; − = no agglutination.

Figure 1

Yeast two-hybrid (Y2H) and pulldown assays. A Y2H. pGADT7-FaeG and pGBKT7-APN were co-expressed in yeast and positive clones were tested for β-galactosidase activity. Samples 1–3: F4ab FaeG-APN; Samples 4–6: F4ac FaeG-APN; Samples 7–9: F4ad FaeG-APN; N: negative control; P: positive control. B GST-pulldown assays. The binding between the recombinant FaeG and APN proteins was studied using the Pierce™ GST Protein Interaction Pull-Down Kit. Western blotting with anti-F4 monoclonal antiserum and anti-APN polyclonal antiserum was used for detection. C Metaperiodate treatment. PVDF membranes were treated with either 0, 10, or 20 mM NaIO4 before using the membranes in Western blots as described in B. Each experiment was repeated three times and representative results are shown.

F4+ binding to IPEC-J2 cells differing in APN expression

To evaluate the potential involvement of APN as an F4+ E. coli receptor, we knocked down APN expression in IPEC-J2 cells using pcDNA™6.2-GW/miR-APN. We observed a substantial reduction in APN expression as determined by using RT-PCR (Figure 2A) and Western blotting (Figure 2B). The adhesion of F4 ETEC to IPEC-J2 cells transfected with pcDNA™6.2-GW/miR-APN was significantly reduced (Figure 3A).
Figure 2

apn knockdown and overexpression in IPEC-J2 cells. A RT-PCR. apn mRNA levels in pEC129-APN-IPEC-J2 cells, pcDNA™6.2-GW/miR-APN-IPEC-J2 cells, and IPEC-J2 cells were quantified using RT-PCR and normalized to gapdh expression. The asterisk indicates a statistically significant difference in expression when compared to the original cells (p < 0.05). B Western blotting. Proteins from IPEC-J2, pEC129-APN-IPEC-J2, and pcDNA™6.2-GW/miR-APN-IPEC-J2 cells were harvested in RIPA buffer. Blots were incubated overnight with polyclonal antibodies against APN and stained with enhanced chemiluminescence (ECL) (Pierce) reagents. Each experiment was repeated three times and representative results are shown.

Figure 3

Modulating APN expression affects ETEC adherence. A Adhesion of F4 E. coli strains to IPEC-J2 cells. Bacterial adherence to the original IPEC-J2 cell line was normalized to 100%. B In vitro inhibition assay. Adherence of F4+ ETEC to IPEC-J2 cells after pre-incubation with anti-F4 fimbriae monoclonal antiserum (1:100 dilution) or with anti-APN polyclonal antiserum (1:1, 1:10, 1:100 dilutions). The adhesion of the untreated samples was normalized 100%. The experiments were repeated three times and data are expressed as mean ± standard deviations (p < 0.05).

The cell line, pEC129-APN-IPEC-J2, that over-expresses APN was also constructed and characterized by using RT-PCR (Figure 2A) and Western blotting (Figure 2B). The adhesion of F4 ETEC to the pEC129-APN-IPEC-J2 cells was substantially increased, as compared with adhesion to the original IPEC-J2 cells (Figure 3A). The addition of both APN polyclonal antiserum and an anti-F4 fimbriae monoclonal antibody to IPEC-J2 cells also reduced ETEC adhesion (Figure 3B).

Discussion

F4+ ETEC infections cause diarrhea in newborn and weaned piglets and fimbriae-mediated adherence to porcine intestinal cells is an initial step in the infection process [39]. The major fimbrial subunit FaeG directly mediates the binding of the three F4 variants to different host receptors [8, 23, 41]. The functional site of the F4ab FaeG subunit is contained within amino acids (AAs) 140-145 and 151-156, while AAs 147-160 dictate binding capacity for F4ac FaeG [40, 41]. The F4ad FaeG subunit interacts with a minimal galactose binding epitope via its D’-D’’-α1-α2 binding domain within AAs 150-152 and 166-170. This D’-α1 loop differs among the FaeG variants and results in their different structural and adhesive properties [42].

While it is known that F4 fimbriae receptors on the gut epithelium determine susceptibility to F4+ ETEC, the identity of these receptors is still under active investigation [3, 43, 44]. Polymorphisms in intron 7 of the MUC4 gene have been used to classify an important percentage of piglets as susceptible or resistant to F4 ETEC [16, 17]. Although Ren et al. and Zhou et al. both found that susceptibility/resistance toward ETEC F4ac is conferred by the MUC13 gene in pigs, Schroyen et al. reported that MUC13 and MUC20 gene expression are not related to ETEC F4ac susceptibility in piglets, and Goetstouwer et al. recently confirmed that MUC4 and MUC13 are not completely associated with F4ab/ac ETEC susceptibility [10, 11, 13, 18].

Several glycoproteins and glycolipids isolated from porcine intestinal cells have been studied for their potential to act as F4 receptors, such as GP74 (TF), IGLad (intestinal neutral glycosphingolipid), and IMTGP (intestinal mucin-type glycoprotein) [43, 45, 46]. However, the functions of these potential receptors are not well characterized.

Here we characterized a newly described receptor for F4+ fimbriae, APN, which also serves as a receptor for the transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), and coronavirus [20, 47, 48]. APN is particularly highly expressed in the intestinal mucosa and is also associated with the MUC4 susceptible genotype [17, 21]. APN was recently described as a potential receptor for F4ac+ fimbriae; variations in the α2-3,6,8 sialic acid binding site of APN result in reduced binding of F4 fimbriae and binding of F4 fimbriae to APN results in clathrin-mediated endocytosis of the fimbriae [20]. Goetstouwers et al. reported that there are no genetic polymorphisms or expression differences in the ANPEP gene that have been associated with F4 ETEC susceptibility and hypothesized that differences in F4 binding to ANPEP are due to modifications in carbohydrate moieties [20, 49].

We found that IPEC-J2 cells express APN and that F4 E. coli was able to adhere to IPEC-J2 cells in an APN-dependent manner. Pre-incubation with APN polyclonal antiserum and anti-F4 fimbriae monoclonal antibody both reduced ETEC adherence to IPEC-J2 cells. Results from Y2H and pulldown assays also showed that FaeG binds directly to APN. We did not find an impact on APN-FaeG binding after treating samples with metaperiodate (NaIO4), suggesting that, at least under our in vitro conditions, APN glycosylation does not play a significant role in FaeG binding. However, the molecular details regarding APN-FaeG interactions and their roles in ETEC adherence await further experimentation.

Notes

Declarations

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

GZ and PX participated in the design of the study. PX, YW, CZ and YZ performed the experiment. PX analyzed the data and drafted the manuscript. GZ, YY, WL, and PRH planned the experiments and helped write the manuscript. All authors read and approved the final manuscript.

Acknowledgements

This study was supported by Grants from the Chinese National Science Foundation Grant (Nos. 30571374, 30771603, 31072136, 31270171), the Genetically Modified Organisms Technology Major Project of China (2014ZX08006-001B), the 948 program Grant No. 2011-G24 from Ministry of Agriculture of the People’s Republic of China, a project founded by the Priority Academic Program of Development Jiangsu High Education Institution, and Innovative Research Team In University “PCSIRT” (IRT0978), a fund of excellent doctorial dissertations from Yangzhou University, Program granted for Scientific Innovation Research of College Graduate in Jiangsu province (KYLX_1359).

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
College of Veterinary Medicine, Yangzhou University
(2)
Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses
(3)
College of Animal Medicine, Nanjing Agriculture University
(4)
College of Veterinary Medicine, Kansas State University

References

  1. Nougayrède JP, Fernandes PJ, Donnenberg MS (2003) Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol 5:359–372View ArticlePubMedGoogle Scholar
  2. Devriendt B, Stuyven E, Verdonck F, Goddeeris BM, Cox E (2010) Enterotoxigenic Escherichia coli (K88) induce proinflammatory responses in porcine intestinal epithelial cells. Dev Comp Immunol 34:1175–1182View ArticlePubMedGoogle Scholar
  3. Sellwood R, Gibbons RA, Jones GW, Rutter JM (1975) Adhesion of enteropathogenic Escherichia coli to pig intestinal brush borders: the existence of two pig phenotypes. J Med Microbiol 8:405–411View ArticlePubMedGoogle Scholar
  4. Van den Broeck W, Cox E, Goddeeris BM (1999) Receptor-dependent immune responses in pigs after oral immunization with F4 fimbriae. Infect Immun 67:520–526PubMed CentralPubMedGoogle Scholar
  5. Bijlsma I, de Nijs A, van der Meer C, Frik J (1982) Different pig phenotypes affect adherence of Escherichia coli to jejunal brush borders by K88ab, K88ac, or K88ad antigen. Infect Immun 37:891–894PubMed CentralPubMedGoogle Scholar
  6. Verdonck F, Cox E, Schepers E, Imberechts H, Joensuu J, Goddeeris BM (2004) Conserved regions in the sequence of the F4 (K88) fimbrial adhesin FaeG suggest a donor strand mechanism in F4 assembly. Vet Microbiol 102:215–225View ArticlePubMedGoogle Scholar
  7. Van den Broeck W, Cox E, Oudega B, Goddeeris BM (2000) The F4 fimbrial antigen of Escherichia coli and its receptors. Vet Microbiol 71:223–244View ArticlePubMedGoogle Scholar
  8. Zhou M, Duan Q, Zhu X, Guo Z, Li Y, Hardwidge PR, Zhu G (2013) Both flagella and F4 fimbriae from F4ac + enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro. Vet Res 44:30PubMed CentralView ArticlePubMedGoogle Scholar
  9. Joensuu JJ, Kotiaho M, Riipi T, Snoeck V, Palva ET, Teeri TH, Lang H, Cox E, Goddeeris BM, Niklander-Teeri V (2004) Fimbrial subunit protein FaeG expressed in transgenic tobacco inhibits the binding of F4ac enterotoxigenic Escherichia coli to porcine enterocytes. Transgenic Res 13:295–298View ArticlePubMedGoogle Scholar
  10. Zhou C, Liu Z, Liu Y, Fu W, Ding X, Liu J, Yu Y, Zhang Q (2013) Gene silencing of porcine MUC13 and ITGB5: candidate genes towards Escherichia coli F4ac adhesion. PLoS One 8:e70303PubMed CentralView ArticlePubMedGoogle Scholar
  11. Schroyen M, Stinckens A, Verhelst R, Geens M, Cox E, Niewold T, Buys N (2012) Susceptibility of piglets to enterotoxigenic Escherichia coli is not related to the expression of MUC13 and MUC20. Anim Genet 43:324–327View ArticlePubMedGoogle Scholar
  12. Rampoldi A, Jacobsen MJ, Bertschinger HU, Joller D, Burgi E, Vogeli P, Andersson L, Archibald AL, Fredholm M, Jorgensen CB, Neuenschwander S (2011) The receptor locus for Escherichia coli F4ab/F4ac in the pig maps distal to the MUC4-LMLN region. Mamm Genome 22:122–129View ArticlePubMedGoogle Scholar
  13. Ren J, Yan X, Ai H, Zhang Z, Huang X, Ouyang J, Yang M, Yang H, Han P, Zeng W, Chen Y, Guo Y, Xiao S, Ding N, Huang L (2012) Susceptibility towards enterotoxigenic Escherichia coli F4ac diarrhea is governed by the MUC13 gene in pigs. PLoS One 7:e44573PubMed CentralView ArticlePubMedGoogle Scholar
  14. Jørgensen CB, Cirera S, Archibald A, Andersson L, Fredholm M, Edfors-Lilia I (2010) Porcine polymorphisms and methods for detecting them, International application published under the patent cooperation treaty (PCT). PCT/DK2003/000807 or WO2004/048606-A2Google Scholar
  15. Jørgensen CB, Cirera S, Anderson SI, Archibald AL, Raudsepp T, Chowdhary B, Edfors-Lilja I, Andersson L, Fredholm M (2003) Linkage and comparative mapping of the locus controlling susceptibility towards E. Coli F4ab/ac diarrhoea in pigs. Cytogenet Genome Res 102:157–162View ArticlePubMedGoogle Scholar
  16. Jacobsen M, Cirera S, Joller D, Esteso G, Kracht SS, Edfors I, Bendixen C, Archibald AL, Vogeli P, Neuenschwander S, Bertschinger HU, Rampoldi A, Andersson L, Fredholm M, Jorgensen CB (2011) Characterisation of five candidate genes within the ETEC F4ab/ac candidate region in pigs. BMC Res Notes 4:225PubMed CentralView ArticlePubMedGoogle Scholar
  17. Nguyen VU, Goetstouwers T, Coddens A, Van Poucke M, Peelman L, Deforce D, Melkebeek V, Cox E (2013) Differentiation of F4 receptor profiles in pigs based on their mucin 4 polymorphism, responsiveness to oral F4 immunization and in vitro binding of F4 to villi. Vet Immunol Immunopathol 152:93–100View ArticlePubMedGoogle Scholar
  18. Goetstouwers T, Van Poucke M, Coppieters W, Nguyen VU, Melkebeek V, Coddens A, Van Steendam K, Deforce D, Cox E, Peelman LJ (2014) Refined candidate region for F4ab/ac enterotoxigenic Escherichia coli susceptibility situated proximal to MUC13 in pigs. PLoS One 9:e105013PubMed CentralView ArticlePubMedGoogle Scholar
  19. Rasschaert K, Devriendt B, Favoreel H, Goddeeris BM, Cox E (2010) Clathrin-mediated endocytosis and transcytosis of enterotoxigenic Escherichia coli F4 fimbriae in porcine intestinal epithelial cells. Vet Immunol Immunopathol 137:243–250View ArticlePubMedGoogle Scholar
  20. Melkebeek V, Rasschaert K, Bellot P, Tilleman K, Favoreel H, Deforce D, De Geest BG, Goddeeris BM, Cox E (2012) Targeting aminopeptidase N, a newly identified receptor for F4ac fimbriae, enhances the intestinal mucosal immune response. Mucosal Immunol 5:635–645View ArticlePubMedGoogle Scholar
  21. Sjostrom H, Noren O, Olsen J (2000) Structure and function of aminopeptidase N. Adv Exp Med Biol 477:25–34View ArticlePubMedGoogle Scholar
  22. Zhou M, Guo Z, Yang Y, Duan Q, Zhang Q, Yao F, Zhu J, Zhang X, Hardwidge PR, Zhu G (2014) Flagellin and F4 fimbriae have opposite effects on biofilm formation and quorum sensing in F4ac + enterotoxigenic Escherichia coli. Vet Microbiol 168:148–153View ArticlePubMedGoogle Scholar
  23. Xia P, Song Y, Zou Y, Yang Y, Zhu G (2015) F4 enterotoxigenic Escherichia coli (ETEC) adhesion mediated by the major fimbrial subunit FaeG. J Basic Microbiol 55:1118–1124View ArticlePubMedGoogle Scholar
  24. Van den Broeck W, Cox E, Goddeeris BM (1999) Receptor-specific binding of purified F4 to isolated villi. Vet Microbiol 68:255–263View ArticlePubMedGoogle Scholar
  25. Duan Q, Zhou M, Zhu X, Yang Y, Zhu J, Bao W, Wu S, Ruan X, Zhang W, Zhu G (2013) Flagella from F18 + Escherichia coli play a role in adhesion to pig epithelial cell lines. Microb Pathog 55:32–38View ArticlePubMedGoogle Scholar
  26. Marbach A, Bettenbrock K (2012) lac operon induction in Escherichia coli: systematic comparison of IPTG and TMG induction and influence of the transacetylase LacA. J Biotechnol 157:82–88View ArticlePubMedGoogle Scholar
  27. Lipman NS, Jackson LR, Trudel LJ, Weis-Garcia F (2005) Monoclonal versus polyclonal antibodies: distinguishing characteristics, applications, and information resources. ILAR J 46:258–268View ArticlePubMedGoogle Scholar
  28. Del Re B, Sgorbati B, Miglioli M, Palenzona D (2000) Adhesion, autoaggregation and hydrophobicity of 13 strains of Bifidobacterium longum. Lett Appl Microbiol 31:438–442View ArticlePubMedGoogle Scholar
  29. Gietz RD, Schiestl RH (2007) Quick and easy yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2:35–37View ArticlePubMedGoogle Scholar
  30. Perales M, Eubel H, Heinemeyer J, Colaneri A, Zabaleta E, Braun HP (2005) Disruption of a nuclear gene encoding a mitochondrial gamma carbonic anhydrase reduces complex I and supercomplex I + III2 levels and alters mitochondrial physiology in Arabidopsis. J Mol Biol 350:263–277View ArticlePubMedGoogle Scholar
  31. Valaitis AP, Podgwaite JD (2013) Bacillus thuringiensis Cry1A toxin-binding glycoconjugates present on the brush border membrane and in the peritrophic membrane of the Douglas–fir tussock moth are peritrophins. J Invertebr Pathol 112:1–8View ArticlePubMedGoogle Scholar
  32. Grange PA, Mouricout MA, Levery SB, Francis DH, Erickson AK (2002) Evaluation of receptor binding specificity of Escherichia coli K88 (F4) fimbrial adhesin variants using porcine serum transferrin and glycosphingolipids as model receptors. Infect Immun 70:2336–2343PubMed CentralView ArticlePubMedGoogle Scholar
  33. Wang L, Sunyer JO, Bello LJ (2004) Fusion to C3d enhances the immunogenicity of the E2 glycoprotein of type 2 bovine viral diarrhea virus. J Virol 78:1616–1622PubMed CentralView ArticlePubMedGoogle Scholar
  34. Leardkamolkarn V, Sirigulpanit W, Chotiwan N, Kumkate S, Huang CY (2012) Development of Dengue type-2 virus replicons expressing GFP reporter gene in study of viral RNA replication. Virus Res 163:552–562PubMed CentralView ArticlePubMedGoogle Scholar
  35. Bolhassani A, Taheri T, Taslimi Y, Zamanilui S, Zahedifard F, Seyed N, Torkashvand F, Vaziri B, Rafati S (2011) Fluorescent Leishmania species: development of stable GFP expression and its application for in vitro and in vivo studies. Exp Parasitol 127:637–645View ArticlePubMedGoogle Scholar
  36. Wang X, Su B, Lee HG, Li X, Perry G, Smith MA, Zhu X (2009) Impaired balance of mitochondrial fission and fusion in Alzheimer’s disease. J Neurosci 29:9090–9103PubMed CentralView ArticlePubMedGoogle Scholar
  37. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622View ArticlePubMedGoogle Scholar
  38. Duan Q, Zhou M, Zhu X, Bao W, Wu S, Ruan X, Zhang W, Yang Y, Zhu J, Zhu G (2012) The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet Microbiol 160:132–140View ArticlePubMedGoogle Scholar
  39. Sugiharto S, Hedemann MS, Jensen BB, Lauridsen C (2012) Diarrhea-like condition and intestinal mucosal responses in susceptible homozygous and heterozygous F4R + pigs challenged with enterotoxigenic Escherichia coli. J Anim Sci 90(Suppl 4):281–283View ArticlePubMedGoogle Scholar
  40. Zhang W, Fang Y, Francis DH (2009) Characterization of the binding specificity of K88ac and K88ad fimbriae of enterotoxigenic Escherichia coli by constructing K88ac/K88ad chimeric FaeG major subunits. Infect Immun 77:699–706PubMed CentralView ArticlePubMedGoogle Scholar
  41. Bakker D, Willemsen PT, Simons LH, van Zijderveld FG, de Graaf FK (1992) Characterization of the antigenic and adhesive properties of FaeG, the major subunit of K88 fimbriae. Mol Microbiol 6:247–255View ArticlePubMedGoogle Scholar
  42. Moonens K, Van den Broeck I, De Kerpel M, Deboeck F, Raymaekers H, Remaut H, De Greve H (2015) Structural and functional insight into the carbohydrate receptor binding of F4 fimbriae-producing enterotoxigenic Escherichia coli. J Biol Chem 290:8409–8419View ArticlePubMedGoogle Scholar
  43. Erickson AK, Billey LO, Srinivas G, Baker DR, Francis DH (1997) A three-receptor model for the interaction of the K88 fimbrial adhesin variants of Escherichia coli with porcine intestinal epithelial cells. Adv Exp Med Biol 412:167–173View ArticlePubMedGoogle Scholar
  44. Francis DH, Grange PA, Zeman DH, Baker DR, Sun R, Erickson AK (1998) Expression of mucin-type glycoprotein K88 receptors strongly correlates with piglet susceptibility to K88(+) enterotoxigenic Escherichia coli, but adhesion of this bacterium to brush borders does not. Infect Immun 66:4050–4055PubMed CentralPubMedGoogle Scholar
  45. Grange PA, Mouricout MA (1996) Transferrin associated with the porcine intestinal mucosa is a receptor specific for K88ab fimbriae of Escherichia coli. Infect Immun 64:606–610PubMed CentralPubMedGoogle Scholar
  46. Grange PA, Erickson AK, Levery SB, Francis DH (1999) Identification of an intestinal neutral glycosphingolipid as a phenotype-specific receptor for the K88ad fimbrial adhesin of Escherichia coli. Infect Immun 67:165–172PubMed CentralPubMedGoogle Scholar
  47. Delmas B, Gelfi J, L’Haridon R, Vogel LK, Sjostrom H, Noren O, Laude H (1992) Aminopeptidase N is a major receptor for the entero-pathogenic coronavirus TGEV. Nature 357:417–420View ArticlePubMedGoogle Scholar
  48. Nam E, Lee C (2010) Contribution of the porcine aminopeptidase N (CD13) receptor density to porcine epidemic diarrhea virus infection. Vet Microbiol 144:41–50View ArticlePubMedGoogle Scholar
  49. Goetstouwers T, Van Poucke M, Van Nguyen U, Melkebeek V, Coddens A, Deforce D, Cox E, Peelman LJ (2014) F4-related mutation and expression analysis of the aminopeptidase N gene in pigs. J Anim Sci 92:1866–1873View ArticlePubMedGoogle Scholar

Copyright

© Xia et al. 2016

Advertisement