Skip to main content
Download PDF

Exosome-delivered miR-153 from Trichinella spiralis promotes apoptosis of intestinal epithelial cells by downregulating Bcl2

Veterinary Research volume 54, Article number: 52 (2023) Cite this article

Abstract

Trichinellosis, a helminthic zoonosis, exhibits a cosmopolitan distribution and is a public health concern. In previous studies, it was reported that the exosomes secreted by Trichinella spiralis larvae (TsExos) largely affected cell biological activities. miRNAs, as exosome-delivered cargoes, affect the biological activities of the host by targeting genes. The present study aimed to elucidate the mechanisms by which miRNAs interact with intestinal epithelial cells. First, a miRNA library of TsExos was constructed; then, based on high-throughput miRNA sequencing results, miR-153 and its predicted target genes, namely, Agap2, Bcl2 and Pten, were selected for follow-up studies. The dual-luciferase reporter assays revealed that miR-153 directly targeted Bcl2 and Pten. Furthermore, real-time qPCR and Western blotting revealed that only Bcl2 was downregulated by TsExo-delivered miR-153 in porcine intestinal epithelial cells (IPEC-J2). Bcl2, an important antiapoptotic protein, plays an essential role in cell apoptosis as a common intersecting molecule of various signal transduction pathways. Therefore, we hypothesized that miR-153 derived from TsExos causes cell apoptosis by targeting Bcl2. The results suggested that miR-153 could induce apoptosis, reduce mitochondrial membrane potential, affect cell proliferation, and cause damage and substantial oxidative stress. Furthermore, miR-153 coincubated with IPEC-J2 cells stimulated the accumulation of the proapoptotic proteins Bax and Bad, which belong to the Bcl2 family of proteins, and the apoptosis-implementing proteins Caspase 9 and Caspase 3. Moreover, studies have suggested that miR-153 can promote apoptosis by regulating the MAPK and p53 signalling pathways involved in apoptosis. Thus, exosome-mediated miR-153 delivery secreted by T. spiralis could induce apoptosis and affect the MAPK and p53 signalling pathways by downregulating Bcl2 in IPEC-J2 cells. The study highlights the mechanisms underlying the invasion of T. spiralis larva.

Introduction

To date, parasitic diseases remain a growing concern worldwide, threatening human health [1]. Current studies mainly focus on the prosurvival mechanisms of parasites in the physiological or immunological environment of the host to achieve long-term parasitism via intercellular communication [2]. Trichinella spiralis is a foodborne zoonotic nematode with various mammalian hosts worldwide. T. spiralis infection is not only a major public hygiene problem but also poses a serious threat to meat safety [3, 4]. As a common intestinal parasite, T. spiralis releases specific proteins or other molecules that interfere with the immune response of host cells, evading detection and attack by the host immune system [5, 6]. Han et al. reported that T. spiralis excretory-secretory (ES) products may regulate host immune responses at the macrophage level [7]. In another study, as an indispensable component of the ES antigen of T. spiralis, a serine protease inhibitor could promote cell apoptosis by activating endoplasmic reticulum stress in intestinal epithelial cells [8]. Therefore, it is important to conduct additional functional studies on the secretory products of T. spiralis to understand the immune mechanisms of T. spiralis.

Recently, advances in exosomal research and its importance in cellular crosstalk, as well as the role played by exosomes in parasite invasion, have received increased attention [9,10,11,12]. Exosomes are membrane vesicles of endocytic origin that are released into the extracellular environment by different living cells [13]. As carriers, exosomes carry a series of bioactive cargos comprising miRNA, mRNA, DNA and proteins and transport them into cells for cell‒cell interplay and biological delivery [2]. The molecular composition of exosomes reflects the specialized functions of their origin. As they are transferred into target cells, exosomes probably modulate selected cellular activities, including vascular homeostasis and antigen presentation [14]. miRNAs are a class of noncoding single-stranded small RNAs with a length of 18–22 nt. They degrade mRNA by binding to the 3′ untranslated region (3′-UTR) of target mRNAs, leading to inhibition of mRNA translation [15].

In a previous study, the effects of exosomes derived from T. spiralis on the barrier function of small intestinal epithelial cells were explored. These exosomes were found to be involved in several cellular biological processes, which ultimately compromised cellular barrier function [16]. Building on the results of a previous study and the nature of exosomes as delivery vehicles, we hypothesized that the biologically active substances delivered by exosomes played a functional role in the entire process. Therefore, in the present study, the focus was on exosomal miRNAs as cargoes to investigate the effects of the miRNAs of T. spiralis exosomes (TsExos) on intestinal epithelial cells.

Materials and methods

Animals and parasite

Female KM mice (25–30 g) were purchased from Harbin Medical University. All mice were maintained under specific pathogen-free (SPF) conditions according to the Chinese Animal Management Ordinance. The study was conducted in accordance with the recommendations of and was approved by the Animal Management Committee of the Northeast Agricultural University.

T. spiralis (strain ISS533) was cultured in KM mice, and muscle larvae (ML) were isolated from the muscles of infected mice using the standard method described previously [17].

Establishment of an exosomal miRNA library

T. spiralis ML were collected from the muscles of mice on the 40th day post-infection and cultured in RPMI-1640 medium with 1% 100 U/mL penicillin/streptomycin at 37 ℃ under 5% CO2 for 48 h. The exosomes secreted in the culture supernatant were isolated by the method described by Lässer et al. [18]. The results of TsExo identification were found in a previous article [16]. Each time before proceeding with downstream experiments, TsExos were subjected to transmission electron microscopy (TEM) (Hitachi, Japan) to confirm their quality, and the concentration of TsExos was measured using a BCA protein assay kit (Meilunbio, China).

Total RNA was extracted from the exosomes and used for high-throughput miRNA sequencing. Library preparation and miRNA sequencing were performed by Bioacme (Wuhan, China). Briefly, total RNA was used as the experimental material for PCR to obtain a small RNA (sRNA) library. The qualified sRNA library was subjected to onboard sequencing using the Illumina HiSeq™ 3000 platform (Illumina, USA). Clean sequencing reads were obtained using the related analysis software of Illumina.

Quantitative real-time PCR

Relative miRNA expression was evaluated using quantitative real-time polymerase chain reaction (qPCR). The forward primer sequences for each detected miRNA were obtained from the established miRNA library (Table 1), and the universal PCR reverse primer was purchased from Sangon Biotech (China). Total miRNA was extracted from the exosomes using the Total RNA Extraction kit (Solarbio, China). After synthesis of cDNA from total RNA using miRNA first-strand cDNA synthesis (tailing reaction), qPCRs were performed using the Roche Light Cycler 480 system. The results were calculated according to the method described by Livak et al. [19]. The qPCRs in subsequent cell assays were performed according to the method as a reference, and the primers used for subsequent qPCR are presented in Table 2.

Table 1 Primers of detected miRNAs for qPCR.
Full size table
Table 2 Primers of the detected genes for qPCR.
Full size table

Cell culture, growth and transfection

Porcine small intestinal epithelial cells (IPEC-J2) and human embryonic kidney 293T cells (293T) were donated by Harbin Veterinary Research Institute. These cells were cultured in 90% DMEM with 10% foetal bovine serum (FBS) (PAN, Germany) and 1% 100 U/mL penicillin/streptomycin. Cells were transfected using Lip2000 (JTS, China) following the manufacturer’s instructions. For the dual-luciferase assay, miR-153 mimics/inhibitor (sequences are presented in Table 3; synthesized by GenePharma, China), plasmid, and Lip2000 were diluted with Opti-MEM (Gibco, USA). Note: miRNA mimics refer to synthetic RNA molecules designed to mimic the function of miRNAs; miRNA inhibitors refer to synthetic oligonucleotide molecules designed to inhibit the activity of miRNAs. After incubation, the transfection solution was cocultured with 293T cells. After 6 h, fresh medium was added, and the transfected cells were fed and grown for an additional 24 h. For the IPEC-J2 cell assays, the miRNA mimics or inhibitor were transfected into cells using Lip2000. After 6 h, the transfected cells were fed fresh medium or cocultured with TsExos and then grown for an additional 24 h. The reference concentration of TsExos was obtained from a previous study [16].

Table 3 Sequencing of miRNA mimics and inhibitor.
Full size table

Screening of potential miRNAs

First, qPCR was performed to verify the TsExo-packaged miRNAs. In brief, different treatment groups were prepared: TsExos were incubated with 100 µg/mL RNase A (RNA digestion reagent; Beyotime, China) at 37 °C for 2 h; TsExos were coincubated with RNase A and 1 mg/mL Proteinase K (Protein degradation reagent; Beyotime, China) at 37 °C for 2 h; after treatment with RNase A and Proteinase K, TsExos were incubated with 0.25% Triton X-100 (used to disrupt the membrane; Biofroxx, Germany) at room temperature for 10 min. Moreover, a PBS control group was set up. Following treatment completion, miRNAs were detected via qPCR. Second, based on the results of qPCR and high-throughput miRNA sequencing, an assay was performed to validate whether the screened candidate miRNAs packaged in the exosomes could be transferred into IPEC-J2 cells. For this, TsExos were cocultured with IPEC-J2 cells at different time points. After incubation, total RNA was harvested from the cells, and candidate miRNA and pre-miRNA levels were measured by qPCR. The forward primer for the candidate pre-miRNA was as follows: AGCGGTGGCCAGTGTCATTT, and a common antisense primer was obtained from Sangon Biotech.

Vector constructions

The pmirGLO Dual-luciferase vectors (MiaoLingbio, China) were used to construct the recombinant plasmids. The PCR-amplified fragment of the mRNA 3′-UTR obtained from IPEC-J2 cells was cloned into the pMD18-T vector (TaKaRa, Japan) and then inserted into pmirGLO to construct the recombinant plasmid pmirGLO-WT (wild type). The primers for target genes are presented in Table 4. Then, according to the binding sites of the miRNA‒mRNA predicted using the RNAhybrid online website, the mutant sequences of target genes were designed, and the recombinant plasmid pmirGLO-MUT (mutative type) was synthesized by General Biol (China).

Table 4 The primers of miRNA‒target mRNA 3′-UTR.
Full size table

Dual-luciferase reporter gene assay

After transfection, a dual-luciferase reporter gene assay kit (Yeasen, China) was used to detect firefly luciferase activity. Both firefly and Renilla luciferase activities were measured using a microplate reader (Tecan, Switzerland). Luciferase activity was calculated by normalizing the firefly luciferase activity relative to the Renilla luciferase activity. The different transfection groups of 293T cells are shown in Table 5.

Table 5 Dual-luciferase assay groups (miRNA-Bcl2 mRNA target pairs).
Full size table

Western blotting

Total proteins were extracted from the cells, and the protein concentration was determined using a BCA assay kit. The proteins were fractionated by using 12% sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS‒PAGE) and transferred onto a polyvinylidene fluoride filter membrane (PVDF; Millipore, USA). After incubation with primary antibodies (Wanleibio, China; Abclonal, USA), the PVDF membrane was washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (Abclonal). Finally, the blot was developed using ultrasensitive ECL chemiluminescence reagent (Meilunbio), and the membrane was exposed. The bands were quantified using a chemiluminescence imaging system (Syngene, USA) and analysed using ImageJ.

Cell viability, permeability, cytotoxicity, and oxidative stress assays

After the treatments, cell viability, cytotoxicity, and oxidative stress assays were performed using a CCK-8 kit, lactate dehydrogenase (LDH) assay kit, and reactive oxygen species (ROS) assay kit (Meilunbio), respectively. The assays were performed according to the manufacturers’ instructions. The permeability of the monolayer IPEC-J2 cells was measured by performing the FITC-dextran assay (40 kDa; Yuanyebio, China) described previously [16].

Cell apoptosis assay

The miRNA-transfected and TsExo-cultured cells were detected using the Annexin V-FITC/PI Cell Apoptosis Kit (Meilunbio) via flow cytometry (FCM). Cells that were stained with PI and FITC were identified as apoptotic cells. Hoechst 33258 (Leagene, China) staining was performed to confirm apoptosis by observing the intensity of blue fluorescence. Mitochondrial membrane potential was measured using a JC-1 Mitochondrial Membrane Potential Assay Kit (Solarbio) under a fluorescence microscope (Syngene).

Statistical analysis

SPSS 22, GraphPad Prism 5, and other software programs were used for statistical analysis. All data are expressed as the mean ± SD. Differences between the groups were assessed using one-way analysis of variance (ANOVA) and Dunnett’s post hoc test. A P-valve of < 0.05 was considered statistically significant. The quantification of the protein band intensities was analysed using ImageJ software.

Results

Exosomal miRNA library

The exosomal miRNAs derived from the muscle larvae of T. spiralis were subjected to high-throughput sequencing. The miRNA library contained 876 086 known miRNA reads, accounting for 11.59% of small RNAs (sRNA) and originating from 48 miRNA families, and 54,227 unknown miRNA reads, accounting for 0.72% of sRNA, with 76 novel miRNAs (Figure 1A, and Tables 6 and 7). To predict the target mRNAs for the known and novel miRNAs, we selected the 3′-UTR of Sus scrofa mRNA in the target gene prediction database. Furthermore, PITA, RNA22, miRmap, microT, miRanda, PicTar, and TargetScan software or online tools were used for target gene prediction. The target mRNAs were subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, with the significance threshold set at P < 0.05. GO and KEGG enrichment analyses are presented in Figures 1B and C.

Figure 1
figure 1

miRNA library ofTsExos. A Statistical graphs of small RNAs (sRNAs). B Box plot of Gene Ontology (GO) enrichment. BP: biological process; CC: cellular component; MF: molecular function. C Dot plot of KEGG enrichment. D Determination of miRNA levels by qPCR.

Full size image
Table 6 The known miRNA sequences in Ts Exos (Top 15).
Full size table
Table 7 Unknown miRNA sequences in Ts Exos (top 15).
Full size table

To validate the miRNA sequencing results, we selected the top eight known miRNAs and top eight novel miRNAs with the highest abundance for qPCR analysis. U6 was used as a reference gene for miRNA identification. The qPCR results revealed that the transcriptional levels of the known and novel miRNAs were consistent with the sequencing results, further validating the accuracy of sequencing (Figure 1D).

Determination of miRNAs and target genes

Due to the limited quantity of lipoproteins and other substances in the exosomes by ultracentrifugation, according to the miRNA sequencing results, we further verified whether the top eight abundant miRNAs were packaged in TsExos. The results showed that after treatment with RNase A, proteinase K, and Triton X-100, the levels of miR-1, 9, 86, 100, 153, and 228 were significantly decreased compared to those with treatment with RNase A alone (P < 0.001), indicating that these miRNAs were mainly packaged in the exosomes, whereas miR-252 and 283 were mainly present outside (Figure 2A). Combining miRNA abundance data, KEGG/GO enrichment analysis results, the predicted miRNA target genes, and the results of miRNAs within the exosomes, we finally selected miR-153 and its predicted target genes Agap2, Bcl2, and Pten for subsequent studies (Tables 8 and 9). Furthermore, confirmation was conducted to determine whether miR-153 was carried into the IPEC-J2 cells by TsExos. The results suggested that there was no significant difference in miR-153 levels at the 3- and 6-h time points (P > 0.05); however, the miR-153 level was significantly increased at the 12- and 24-h time points compared with the control (P < 0.001); the level continuously increased as time increased (Figure 2B). As shown in Figure 2C, after coincubation of IPEC-J2 cells with exosomes for 12 or 24 h, no significant difference in pre-miR-153 content was observed compared with the control (P > 0.05); this indicated that the increase in miR-153 content in IPEC-J2 cells was mainly derived from TsExos rather than from the activation of the endogenous miR-153 synthesis system.

Figure 2
figure 2

Determination of candidate miRNAs. A Identification of the most abundant miRNAs within TsExos by qPCR. B TsExos were incubated with IPEC-J2 cells for 3, 6, 12, and 24 h to evaluate the miR-153 content in cells by qPCR. C The TsExos were incubated with IPEC-J2 for 12 and 24 h to evaluate the pre-miR-153 content in cells by qPCR. The data were analysed from 3 independent experiments, and the data are expressed as the mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001 compared with the PBS group.

Full size image
Table 8 Partial KEGG enrichment pathways in the miRNA library.
Full size table
Table 9 The miR-153 predicted target genes and pathways.
Full size table

Identification of the targeting relationship between miRNA and mRNA

The mRNA 3′-UTR sequences of the target genes Agap2, Bcl2, and Pten were obtained from GenBank. The binding sites between miR-153 and the 3′-UTR of target genes were predicted using the online tool RNAhybrid, and the minimum free energy value should be −20 kcal/mol. Based on the binding sites of miR-153 to the 3′-UTRs of Agap2, Bc12, and Pten mRNA obtained from RNAhybrid (Figure 3A), primers were designed to amplify the fragments containing the binding sites. With total DNA from IPEC-J2 cells as the template, PCR amplification successfully resulted in the production of Agap2 (232 bp), Bcl2 (376 bp), and Pten (217 bp) fragments (Figure 3B); these three gene sequences had an identity of 100% with the nucleotide sequences registered in GenBank. Then, three different recombinant plasmids were constructed by inserting the three target fragments into the 3′-UTR of the firefly luciferase gene in the pmirGLO vector. The recombinant plasmids were identified via double digestion with XhoI and SalI (TaKaRa, Japan). In subsequent electrophoresis, a 7350 bp pmirGLO band and the corresponding band for the exogenous genes were obtained (Figure 3D), and the results of sequencing confirmed a 100% sequence concordance (Additional file 1), indicating the successful construction of three kinds of recombinant plasmids: pmirGLO-Agap2/Bcl2/Pten 3′-UTR-WT. Likewise, according to the potential miRNA targeting sites within the 3′-UTRs, point mutations were introduced by a single base substitution (A → T, T → A, G → C, and C → G). The schematic representation of gene point mutations is shown in Figure 3C, and the mutant sequences are presented in Additional file 2. Immediately after, three kinds of mutant 3′-UTRs were inserted into pmirGLO plasmids. Figure 3E and Additional file 3 demonstrate that three different pmirGLO-MUT plasmids were also obtained after double digestion verification and sequencing comparison.

Figure 3
figure 3

Verification of the targeting relationship between miR-153 and Agap2, Bcl2 and Pten. A Base pairings between the mRNA targets (Agap2, Bcl2 and Pten) and miR-153 were predicted by RNAhybrid. B Schematic representation of point mutations. Promoter: PGK, SV40; Fluc: firefly luciferase; Rluc: Renilla luciferase. The electrophoresis results of (C) PCR amplification of the target gene fragment (Agap2 232 bp, Bcl2 376 bp, and Pten 217 bp), D double-enzyme digestion of recombinant pmirGLO-WT vectors, and E double-enzyme digestion of recombinant pmirGLO-MUT vectors. The miR-153 and Agap2 F, Bcl2 G and Pten H mRNA targeting relationships were detected by a dual-luciferase assay system. Calculation formula of the dual-luciferase assay: Ratio = F (experimental group - control group)/R (experimental group–control group). F: Firefly luciferase activity; R: Renilla luciferase activity; The control group: untransfected cells. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate the significance levels of the comparisons between the mimic NC group and the mimic group, as well as between the inhibitor NC group and the inhibitor group.

Full size image

The 293T cells were transfected with the pmirGLO luciferase construct (pmirGLO, pmirGLO-MUT or pmirGLO-WT) and miR-153 mimics or inhibitor, and the dual-luciferase reporter gene assay was performed to verify the targeting associations of miRNA‒mRNA. In the verification assays for Bcl2 and Pten mRNA, after normalization of the relative firefly luciferase activities against Renilla luciferase activities, the luciferase activity assay showed that miR-153 markedly inhibited firefly luciferase activity (P < 0.01; P < 0.001) (Figures 3G and H); however, in the assay for Agap2 mRNA, there were no alterations in firefly luciferase activity in Figure 3F. These results indicated that miR-153 could directly target Bcl2 and Pten mRNAs rather than Agap2 and then regulate mRNA translation.

Effects of miR-153 on the physiological and biochemical states of IPEC-J2 cells

Bcl2 and Pten protein levels were determined to evaluate the efficiency of the transfection of the miR-153 mimics in IPEC-J2 cells. The qPCR results demonstrated that in a comparison of the PBS group (the blank control group consisted of untreated cells) with the mimic NC group, no changes were observed in the transcription levels of Bcl2 and Pten, indicating that the infection process had no impact on the IPEC-JE cells. (Note: In the subsequent results analysis, the PBS control group was compared to the miR-153 mimic NC group by default, without specific description, indicating no significant difference between the two.) Treatment with 50 nM (nmol/L) or 100 nM miR-153 mimics significantly decreased the transcriptional levels of Bcl2 or Pten (P < 0.001), respectively, and the levels of Bcl2 and Pten remained decreased as the concentration further increased (Figure 4A). However, the qPCR results validated the reliability of the dual luciferase reporter gene assay. For convenience, 100 nM was selected as the working concentration. To avoid the effect on target gene expression, we inhibited miR-153 activity using a miR-153 inhibitor. The levels of Bcl2 and Pten were remeasured in cells transfected with miR-153 inhibitor followed by coculture with TsExos. The results showed that the transcriptional level of Bcl2 in the miR-153 inhibitor group was significantly increased and that it rescued the low level caused by miR-153 compared with the inhibitor NC (negative control) (P < 0.001). However, the content of Pten remained low, indicating that the ability of miR-153 to reduce Pten expression in TsExos was impeded by other substances (Figure 4B). The results of Western blotting were consistent with those of qPCR, revealing that TsExo-packaged miR-153 only targeted Bcl2 for degradation (Figure 4C). Hence, miR-153 and its target mRNA Bcl2 were investigated in follow-up assays.

Figure 4
figure 4

Effects of miR-153 on IPEC-J2 cells. IPEC-J2 cells were transfected with miR-153 mimics or transfected with miR-153 inhibitor and then incubated with TsExos. Then, the assays were carried out. A Determination of the transfection efficiency of different concentrations of miR-153 mimics. B Changes in the transcription level of target genes after inhibiting TsExo-cargoed miR-153. C Western blotting was performed to detect the modulation of target genes via miR-153. The effect of miR-153 on cell proliferation through the CCK-8 assay at OD450 values D, on cell damage by assessing the level of LDH at OD490 E, on cell permeability by detecting fluorescence intensity of FITC-dextran at 493-nm excitation and 517-nm emission wavelengths F, on cell oxidative stress detected by the fluorescence microplate reader at 488-nm excitation and 525-nm emission wavelengths G, and the fluorescence microscope at 20× PL FL magnification H. All assays were performed in triplicate, and data are presented as the mean ± SD. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate the significance levels of the comparisons between the mimic NC group and the mimic group, as well as between the inhibitor NC group and the inhibitor group.

Full size image

The CCK-8 kit was used to measure the effect of TsExo-packaged miR-153 on cell proliferation. At the three measurement time points (12, 24, and 36 h), the extent of cell vitality reduction was the highest at 24 h after transfection (P < 0.001). Therefore, 24 h post-transfection with miRNA mimics was chosen. In contrast, the miR-153 inhibitor group had a higher proliferation than the inhibitor NC group (Figure 4D). Similarly, the LDH and ROS assays revealed that the LDH and ROS contents in the miR-153-transfected cells were significantly higher than those in the control cells (P < 0.05; P < 0.001). In contrast, the miR-153 inhibitor reduced the accumulation of LDH or ROS in the IPEC-J2 cells treated with TsExos (P < 0.05; P < 0.001) (Figures 4E, G, and H). Nevertheless, in the membrane permeability assay, no significant changes were observed by assessing the FITC-dextran levels, which permeated through the monolayer to the lower chamber (Figure 4F). Taken together, these results suggested that TsExo-delivered miR-153 could reduce IPEC-J2 viability, cause cell damage, and lead to high levels of cellular oxidative stress without altering cell permeability.

Effects of miR-153 on cell apoptosis

Bcl2, which is targeted by miR-153, is an antiapoptotic molecule functioning through the mitochondrial apoptotic pathway. As a result, we speculated that miR-153 affected the mitochondria-mediated endogenous apoptosis pathway. For the cell apoptosis assays, the FCM results showed that compared with the NC group, the miR-153 mimic group had a 2.85-fold increase in the apoptosis rate, and the miR-153 inhibitor group had a 2.32-fold decrease in the apoptosis rate compared with the inhibitor NC group (Figure 5A). As shown in Figure 5B, the nuclei of live cells stained with Hoechst 33,258 were homogenously stained blue, whereas the miR-153 mimic group had more apoptotic cells with nuclear condensation and deep staining. In contrast, the number of deeply stained apoptotic cells in the miR-153 inhibitor group was significantly decreased compared with that in the inhibitor NC group. For the JC-1 assay, the normal cells in the PBS and NC groups held polarized mitochondrial membrane potentials and exhibited red fluorescence owing to the accumulation of JC-1 in the mitochondria. However, as the miR-153 content increased, the depolarized mitochondrial membrane potential decreased in JC-1 red fluorescence and increased in JC-1 green fluorescence, indicating that the mitochondrial membrane potential was hampered. Conversely, cells exhibited red fluorescence, and the number of green fluorescent cells was reduced by inhibiting miR-153 function (Figure 5C).

Figure 5
figure 5

Effects of miR-153 on cell apoptosis. IPEC-J2 cells were transfected with miR-153 mimics or transfected with miR-153 inhibitor and then incubated with TsExos. Then, the assays were carried out. Apoptosis of IPEC-J2 cells was determined by staining with annexin V and PI followed by flow cytometry (A) or by staining with Hoechst 33258 (B). (C) Detection of variations in mitochondrial membrane potential by performing JC-1 staining. Changes in Bcl2 family proteins were verified by Western blotting (D) and qPCR (E). Verification of apoptosis protein expression changes by Western blots (F) and qPCR (G). All assays were performed in triplicate, and data are presented as the mean ± SD. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate the significance levels of the comparisons between the mimic NC group and the mimic group, as well as between the inhibitor NC group and the inhibitor group.

Full size image

Directly thereafter, the members of the Bcl2 family and apoptotic proteins were detected. The results of qPCR and Western blotting displayed higher Bax and Bad expression in the miR-153 mimic group than in the NC group (P < 0.001). In contrast, a decrease in miR-153 accumulation lowered the content of Bax and Bad. Furthermore, the results of qPCR and Western blotting demonstrated that miR-153 had no impact on Bcl-xL and Bid expression, respectively (Figures 5D and E). In addition, the apoptosis executioner proteins Caspase 9 and Caspase 3 were markedly increased after an increase in exogenous miR-153 levels in IPEC-J2 cells; in contrast, the levels of these proteins were reduced by the miR-153 inhibitor (Figures 5F and G). In summary, the results suggested that TsExo-cargoed miR-153 could induce an increase in apoptosis, possibly by targeting Bcl2 and/or increasing Bax and Bad levels to affect mitochondria-mediated apoptosis and subsequently activating Caspase 9 and Caspase 3 to execute the apoptotic process.

Effects of miR-153 on apoptosis-related pathways

To evaluate the effects of TsExo-delivered miR-153 on the apoptosis-regulated signalling pathways in IPEC-J2 cells, we determined the transcriptional and protein levels of molecules involved in the MAPK, p53, and PI3K/AKT signalling pathways. Both qPCR and Western blotting revealed that genes related to the ERK-p38-MAPK signalling pathways were involved and that TsExo-packaged miR-153 could significantly reduce ERK2 and MER1 expression and significantly increase p38 and phosphorylated p38 (p-p38) levels. Moreover, the miR-153 mimics did not affect ERK1 and MEK2 protein expression in IPEC-J2 cells; however, TsExos could decrease the expression of ERK1 without any clear reason (Figures 6A and B). Similarly, analysis of the p53 signalling pathway showed that miR-153 within TsExos could decrease protein p53 and phosphorylated p53 (p-p53) levels (Figures 6C and D). Furthermore, the findings revealed that for the PI3K/AKT signalling pathway, TsExos, rather than miR-153, significantly decreased the expression level of PI3K while significantly increasing the expression levels of AKT and phosphorylated AKT (p-AKT) (Figures 6E and F).

Figure 6
figure 6

Effects of miR-153 on apoptosis-regulated signalling pathways in IPEC-J2 cells. IPEC-J2 cells were transfected with miR-153 mimics or transfected with miR-153 inhibitor and then incubated with TsExos. Then, the assays were carried out. The protein expression levels of key effectors in the MAPK, p53, and PI3K/AKT signalling pathways were evaluated using Western blotting (A, C, E) and qPCR (B, D, F). All assays were performed in triplicate, and data are presented as the mean ± SD. *P < 0.05, **P < 0.01, and ***P < 0.001 indicate the significance levels of the comparisons between the mimic NC group and the mimic group, as well as between the inhibitor NC group and the inhibitor group.

Full size image

In summary, miR-153 derived from TsExos could promote cell apoptosis by regulating the ERK-p38-MAPK and p53 signalling pathways instead of the PI3K/AKT signalling pathway, specifically by reducing the expression levels of ERK2 and MEK1 and increasing those of p38 and p53.

Discussion

Exosomes produced by parasites are considered “bridges” that facilitate communication between parasites and their hosts during infection, serving as an additional means by which helminths manipulate their hosts [20]. In a previous study, it was found that exosomes derived from T. spiralis could affect the barrier function and immune responses of intestinal epithelial cells. In general, exosomes are small endocytic membrane vesicles that are released by many cells, mediating cell‒cell communication by delivering their cargoes, such as miRNAs [13, 21]. The exosomal shuttle miRNA can be functional in this new location, modifying recipient cell protein production and gene expression and in turn providing the necessary signals to modulate recipient cell functions [22]. It is important to identify the miRNAs within TsExos that interact with the host immune pathway to enhance our understanding of the interplay between the parasite and its host. In the present study, we aimed to discuss the effects of TsExo-delivered miR-153 on IPEC-J2 cells.

miRNA can regulate the transcription and translation of mRNA by binding to the 3′-UTR of the target mRNA, leading to mRNA cleavage or translational repression. Therefore, the function of the miRNA is determined by its downstream target gene [23]. In addition, in the mechanism of different diseases, the same miRNA can regulate multiple target genes and serve different functions. A study reported that miR-153 regulates the apoptosis and autophagy of cardiomyocytes by targeting Mcl-1 [24]. Other studies have reported that miR-153 promotes breast cancer cell apoptosis by targeting HECTD3 and suppresses human laryngeal squamous cell carcinoma migration by targeting the SNAI1 gene [25, 26]. In summary, numerous studies have demonstrated that miR-153 plays a critical role in the regulation of tumours, cancer and neurological diseases [26, 27]. Understanding miRNA function and how it regulates biological processes depends on elucidating the miRNA targets. In this study, the targeting relationship between the candidate genes Agap2, Bcl2, Pten, and miR-153 was initially validated. The results indicated that Bcl2 and Pten were the downstream target genes of miR-153. Nevertheless, the functions of miR-153 within TsExos were limited by unknown components that repress the translation of its own target Pten. Thus, we focused on elucidating the functions of miR-153 given the functions of the target gene Bcl2.

Some studies have suggested that miR-153 participates in and regulates multiple cellular biological processes, including cell proliferation, oxidative stress and cell permeability [28,29,30]. TsExo-delivered miR-153 decreased the viability of IPEC-J2 cells, induced cellular damage, and increased oxidative stress levels, while not affecting cell permeability, demonstrating that miR-153 played a vital role in modulating multiple cellular biological processes affected by TsExos.

The Bcl2 family of proteins is considered the main intracellular regulator of the apoptotic process and is involved in the mitochondria-dependent apoptosis pathway. Cellular survival controlled by the apoptotic process is determined by the equilibrium between the upregulation and downregulation of proapoptotic proteins such as Bax, Bid, and Bad and antiapoptotic proteins such as Bcl-xL [31, 32]. Moreover, the target gene Bcl2 is one of the products of the Bcl2 family and exhibits antiapoptotic and prosurvival functions [33]. In the present study, we demonstrated that miR-153 is a proapoptotic factor in IPEC-J2 cells, consistent with the findings of other studies that miR-153 functions as an apoptosis-inducing factor [34, 35]. MiR-153 could influence the process of IPEC-J2 cell apoptosis by increasing the expression of Bax and Bad associated with the mitochondrial-mediated apoptotic pathway. However, further studies are warranted to determine whether the downregulation of the target gene Bcl2 mediated by miR-153 enhances the expression of Bax and Bad and ultimately leads to apoptosis. Notably, apoptosis is a vital protective mechanism in organisms and plays a crucial role in maintaining host intestinal barrier function. However, the apoptosis induced by parasites is not always beneficial to the host; instead, it serves as an adaptive strategy employed by parasites. By manipulating host cell apoptosis, parasites can evade detection and clearance by the host immune system [36]. In this study, the induction of intestinal epithelial cell apoptosis by miR-153 contained in TsExos may be attributed to this mechanism.

The MAPK signalling pathway regulates several biological processes through various cellular mechanisms, including apoptosis. The MAPK family includes the ERK, JNK, and p38 MAPK subfamilies. After the MAPK signalling cascade is activated, ERK functions as an antiapoptotic pathway by its key proteins ERK and MEK, whereas p38 exerts proapoptotic effects during apoptosis [37, 38]. Furthermore, the p53 pathway is a classic apoptosis pathway. The key gene p53 is an activator of cell apoptosis, and inhibiting the p53 gene significantly reduces cell apoptosis [39]. In addition, the PI3K/Akt-mediated signalling pathway plays a prosurvival role against apoptosis [40]. Many studies have emphasized the importance of miR-153 in regulating apoptosis-related signalling pathways. For example, Yang et al. found that miR-153 overexpression increases phosphorylated p38 and ATF2 and downstream differentiation markers in GSCs [41]. Another study showed that Krüppel-like factor 5 (KLF5) is a target of miR-153 and can interact with p53 [42]. In the present study, it was concluded that cellular apoptosis was triggered by miR-153 and achieved by regulating the ERK-p38-MAPK and p53 signalling pathways, as opposed to the PI3K/AKT signalling pathway. Moreover, many studies have reported that Bcl2, as a crucial intersection, highlights its involvement in a wide web of apoptosis-regulated signalling pathways, including the MAPK, p53 and PI3K/AKT signalling pathways [43,44,45]. However, whether miR-153 modulates the MAPK and p53 signalling pathways by targeting Bcl2 remains unknown.

In conclusion, miR-153 delivered by TsExos participated in the regulation of various biological processes in IPEC-J2 cells by inhibiting the target gene Bcl2. MiR-153 could reduce cell viability and cause cell damage and excessive oxidative stress. Furthermore, it was confirmed that TsExo-cargoed miR-153 could trigger apoptosis, possibly by repressing Bcl2 and/or increasing Bax and Bad levels to affect mitochondria-mediated apoptosis or by regulating the apoptosis-related signalling pathways ERK-p38-MAPK and p53. Therefore, miR-153 within TsExos might be a key factor in the interaction between T. spiralis and host cells.

Availability of data and materials

The datasets used or analysed during the current study are available from the corresponding author on reasonable request.

References

  1. Wang L, Liu T, Chen G, Li Y, Zhang S, Mao L, Liang P, Fasihi Harandi M, Li T, Luo X (2021) Exosomal microrna let-7-5p from Taenia pisiformis cysticercus prompted macrophage to M2 polarization through inhibiting the expression of c/ebp δ. Microorganisms 9:1403

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Wu ZY, Wang LL, Li JY, Wang LF, Wu ZD, Sun X (2019) Extracellular vesicle-mediated communication within host–parasite interactions. Front Immunol 9:3066

    Article  PubMed  PubMed Central  Google Scholar 

  3. Kobpornchai P, Flynn RJ, Reamtong O, Rittisoonthorn N, Kosoltanapiwat N, Boonnak K, Boonyuen U, Ampawong S, Jiratanh M, Tattiyapong M, Adisakwattana P (2020) A novel cystatin derived from Trichinella spiralis suppresses macrophage-mediated inflammatory responses. PLoS Negl Trop Dis 14:e0008192

    Article  PubMed  PubMed Central  Google Scholar 

  4. Sun GG, Ren HN, Liu RD, Song YY, Qi X, Hu CX, Yang F, Jiang P, Zhang X, Wang ZQ, Cui J (2018) Molecular characterization of a putative serine protease from Trichinella spiralis and its elicited immune protection. Vet Res 49:59

    Article  PubMed  PubMed Central  Google Scholar 

  5. Ilic N, Gruden-Movsesijan A, Sofronic-Milosavljevic L (2012) Trichinella spiralis: shaping the immune response. Immunol Res 52:111–119

    Article  CAS  PubMed  Google Scholar 

  6. Bashi T, Bizzaro G, Ben-Ami Shor D, Blank M, Shoenfeld Y (2015) The mechanisms behind helminth’s immunomodulation in autoimmunity. Autoimmun Rev 14:98–104

    Article  CAS  PubMed  Google Scholar 

  7. Han C, Yu J, Zhang Z, Zhai P, Zhang Y, Meng S, Yu Y, Li X, Song M (2019) Immunomodulatory effects of Trichinella spiralis excretory-secretory antigens on macrophages. Exp Parasitol 196:68–72

    Article  CAS  PubMed  Google Scholar 

  8. Xu J, Pang Z, Zhang J, Xia S, Wang R, Zhang Y, Zhen J, Song X, Lin L, Sun F, Xuan X, Lu Y (2022) Regulatory effects of Trichinella spiralis and a serine protease inhibitor on the endoplasmic reticulum stress response of intestinal epithelial cells. Vet Res 53:18

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Pope SM, Lasser C (2013) Toxoplasma gondii infection of fibroblasts causes the production of exosome-like vesicles containing a unique array of mRNA and miRNA transcripts compared to serum starvation. J Extracell Vesicles 2:22484

    Article  Google Scholar 

  10. Kramer S, Piper S, Estevez A, Carrington M (2016) Polycistronic trypanosome mRNAs are a target for the exosome. Mol Biochem Parasitol 205:1–5

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Garcia-Silva MR, Cabrera-Cabrera F, das Neves RF, Souto-Padron T, de Souza W, Cayota A (2014) Gene expression changes induced by Trypanosoma cruzi shed microvesicles in mammalian host cells: relevance of tRNA-derived halves. Biomed Res Int 2014:305239

    Article  PubMed  PubMed Central  Google Scholar 

  12. Samoil V, Dagenais M, Ganapathy V, Aldridge J, Glebov A, Jardim A, Ribeiro P (2018) Vesicle-based secretion in schistosomes: analysis of protein and microRNA (miRNA) content of exosome-like vesicles derived from Schistosoma mansoni. Sci Rep 8:3286

    Article  PubMed  PubMed Central  Google Scholar 

  13. van Niel G, Porto-Carreiro I, Simoes S, Raposo G (2006) Exosomes: a common pathway for a specialized function. J Biochem 140:13–21

    Article  PubMed  Google Scholar 

  14. Ikoma M, Gantt S, Casper C, Ogata Y, Zhang Q, Basom R, Dyen MR, Rose TM, Barcy S (2018) KSHV oral shedding and plasma viremia result in significant changes in the extracellular tumorigenic mirna expression profile in individuals infected with the malaria parasite. PLoS One 13:e0192659

    Article  PubMed  PubMed Central  Google Scholar 

  15. Eckstein F (2005) Small non-coding RNAs as magic bullets. Trends Biochem Sci 30:445–452

    Article  CAS  PubMed  Google Scholar 

  16. Wang R, Zhang Y, Zhen J, Zhang J, Pang Z, Song X, Lin L, Sun F, Lu Y (2022) Effects of exosomes derived from Trichinella spiralis infective larvae on intestinal epithelial barrier function. Vet Res 53:87

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Gu Y, Wei J, Yang J, Huang J, Yang X, Zhu X (2013) Protective immunity against Trichinella spiralis infection induced by a multi-epitope vaccine in a murine model. PLoS One 8:e77238

    Article  CAS  PubMed Central  Google Scholar 

  18. Lasser C, Eldh M, Lotvall J (2012) Isolation and characterization of RNA-containing exosomes. J Vis Exp 59:e3037

    Google Scholar 

  19. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402–408

    Article  CAS  PubMed  Google Scholar 

  20. Eichenberger RM, Sotillo J, Loukas A (2018) Immunobiology of parasitic worm extracellular vesicles. Immunol Cell Biol 96:704–713

    Article  Google Scholar 

  21. Vlassov AV, Magdaleno S, Setterquist R, Conrad R (2012) Exosomes: current knowledge of their composition, biological functions, and diagnostic and therapeutic potentials. Biochim Biophys Acta 1820:940–948

    Article  CAS  PubMed  Google Scholar 

  22. Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ, Lotvall JO (2007) Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol 9:654–659

    Article  CAS  PubMed  Google Scholar 

  23. Fabian MR, Sonenberg N, Filipowicz W (2010) Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem 79:351–379

    Article  CAS  PubMed  Google Scholar 

  24. Zou Y, Liu W, Zhang J, Xiang D (2016) MiR-153 regulates apoptosis and autophagy of cardiomyocytes by targeting Mcl-1. Mol Med Rep 14:1033–1039

    Article  CAS  PubMed  Google Scholar 

  25. Wu X, Li L, Li Y, Liu Z (2016) MiR-153 promotes breast cancer cell apoptosis by targeting HECTD3. Am J Cancer Res 6:1563–1571

    CAS  PubMed  PubMed Central  Google Scholar 

  26. Zhang B, Fu T, Zhang L (2018) MicroRNA-153 suppresses human laryngeal squamous cell carcinoma migration and invasion by targeting the SNAI1 gene. Oncol Lett 16:5075–5083

    PubMed  PubMed Central  Google Scholar 

  27. Fragkouli A, Doxakis E (2014) MiR-7 and miR-153 protect neurons against MPP(+)-induced cell death via upregulation of mTOR pathway. Front Cell Neurosci 8:182

    Article  PubMed  PubMed Central  Google Scholar 

  28. Liu L, Lai X, Yuan C, Lv X, Yu T, He W, Liu J, Zhang H (2018) Aberrant expression of miR-153 is associated with the poor prognosis of cervical cancer. Oncol Lett 15:9183–9187

    PubMed  PubMed Central  Google Scholar 

  29. Zhu J, Wang S, Qi W, Xu X, Liang Y (2018) Overexpression of miR-153 promotes oxidative stress in MPP(+)-induced PD model by negatively regulating the Nrf2/HO-1 signaling pathway. Int J Clin Exp Pathol 11:4179–4187

    CAS  PubMed  PubMed Central  Google Scholar 

  30. Leng X, Ma J, Liu Y, Shen S, Yu H, Zheng J, Liu X, Liu L, Chen J, Zhao L, Ruan X, Xue Y (2018) Mechanism of piR-DQ590027/miR17HG regulating the permeability of glioma conditioned normal BBB. J Exp Clin Cancer Res 37:246

    Article  PubMed  PubMed Central  Google Scholar 

  31. King KL, Cidlowski JA (1998) Cell cycle regulation and apoptosis. Annu Rev Physiol 60:601–617

    Article  CAS  PubMed  Google Scholar 

  32. Alladi PA, Roy T, Singh N, Wadhwa S (2005) Prenatal auditory enrichment with species-specific calls and sitar music modulates expression of Bcl-2 and bax to alter programmed cell death in developing chick auditory nuclei. Int J Dev Neurosci 23:363–373

    Article  CAS  PubMed  Google Scholar 

  33. Wu IC, Zhao Y, Zhai R, Liu CY, Chen F, Ter-Minassian M, Asomaning K, Su L, Heist RS, Kulke MH, Liu G, Christiani DC (2011) Interactions between genetic polymorphisms in the apoptotic pathway and environmental factors on esophageal adenocarcinoma risk. Carcinogenesis 32:502–506

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Zhang Z, Sun J, Bai Z, Li H, He S, Chen R, Che X (2015) MicroRNA-153 acts as a prognostic marker in gastric cancer and its role in cell migration and invasion. Onco Targets Ther 8:357–364

    PubMed  PubMed Central  Google Scholar 

  35. Zhao S, Deng Y, Liu Y, Chen X, Yang G, Mu Y, Zhang D, Kang J, Wu Z (2013) MicroRNA-153 is tumor suppressive in glioblastoma stem cells. Mol Biol Rep 40:2789–2798

    Article  CAS  PubMed  Google Scholar 

  36. Kapczuk P, Kosik-Bogacka D, Kupnicka P, Metryka E, Simińska D, Rogulska K, Skórka M, Gutowska I, Chlubek D, Baranowska-Bosiacka I (2020) The influence of selected gastrointestinal parasites on apoptosis in intestinal epithelial cells. Biomolecules 10:674

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Cagnol S, Chambard JC (2010) ERK and cell death: mechanisms of ERK-induced cell death–apoptosis, autophagy and senescence. FEBS J 277:2–21

    Article  CAS  PubMed  Google Scholar 

  38. Yue J, Lopez JM (2020) Understanding MAPK signaling pathways in apoptosis. Int J Mol Sci 21:2346

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Tovar C, Graves B, Packman K, Filipovic Z, Higgins B, Xia M, Tardell C, Garrido R, Lee E, Kolinsky K, To KH, Linn M, Podlaski F, Wovkulich P, Vu B, Vassilev LT (2013) MDM2 small-molecule antagonist RG7112 activates p53 signaling and regresses human tumors in preclinical cancer models. Cancer Res 73:2587–2597

    Article  CAS  PubMed  Google Scholar 

  40. Vanhaesebroeck B, Guillermet-Guibert J, Graupera M, Bilanges B (2010) The emerging mechanisms of isoform-specific PI3K signalling. Nat Rev Mol Cell Biol 11:329–341

    Article  CAS  PubMed  Google Scholar 

  41. Yang W, Shen Y, Wei J, Liu F (2015) MicroRNA-153/Nrf-2/Gpx1 pathway regulates radiosensitivity and stemness of glioma stem cells via reactive oxygen species. Oncotarget 6:22006–22027

    Article  PubMed  PubMed Central  Google Scholar 

  42. He M, Sun H, Pang J, Guo X, Huo Y, Wu X, Liu Y, Ma J (2018) Propofol alleviates hypoxia-induced nerve injury in PC-12 cells by up-regulation of microRNA-153. BMC Anesthesiol 18:197

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Trouillas M, Saucourt C, Duval D, Gauthereau X, Thibault C, Dembele D, Feraud O, Menager J, Rallu M, Pradier L, Boeuf H (2008) Bcl2, a transcriptional target of p38alpha, is critical for neuronal commitment of mouse embryonic stem cells. Cell Death Differ 15:1450–1459

    Article  CAS  Google Scholar 

  44. Esposito F, Tornincasa M, Chieffi P, De Martino I, Pierantoni GM, Fusco A (2010) High-mobility group A1 proteins regulate p53-mediated transcription of Bcl-2 gene. Cancer Res 70:5379–5388

    Article  CAS  PubMed  Google Scholar 

  45. Han Z, Hong L, Han Y, Wu K, Han S, Shen H, Li C, Yao L, Qiao T, Fan D (2007) Phospho AKT mediates multidrug resistance of gastric cancer cells through regulation of P-gp, Bcl-2 and bax. J Exp Clin Cancer Res 26:261–268

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank all the staff members who provided laboratory assistance.

Funding

This work was supported by the National Natural Science Foundation of China (31372427) and the Development Fund Project of the State Key Laboratory of Pathogen Biology of Livestock Diseases (SKLVEB2019KFKT011).

Author information

Authors and Affiliations

  1. Heilongjiang Provincial Key Laboratory of Zoonosis, College of Veterinary Medicine, Northeast Agricultural University, Harbin, China

    Ruibiao Wang, Lihao Lin, Yang Han, Zhixin Li, Jingbo Zhen, Yuheng Zhang, Feng Sun & Yixin Lu

Authors
  1. Ruibiao Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Lihao Lin
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yang Han
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Zhixin Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jingbo Zhen
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Yuheng Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Feng Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Yixin Lu
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

YL and RW designed this study. RW, LL, YH, ZL, JZ, YZ and FS performed the experiments. YL and RW drafted and revised the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Yixin Lu.

Ethics declarations

Ethics approval and consent to participate

The experiments were approved by the Animal Ethics Committee of Harbin Medical University and were performed in accordance with animal ethics guidelines and approved protocols (Animal Ethics Committee approval number SYXK [Hei] 2016-007).

Competing interests

The authors declare that they have no competing interests.

Additional information

Communicated by Frank Katzer.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1.

Sequencing comparisonresults of WT-Agap2, Bcl2 and Pten.“NCBI WT-Agap2 3'-UTR”represents the Agap2 3′-UTR sequences obtainedfrom GenBank. “Sequencing WT-Agap2 3′-UTR” represents the sequencing results of the WT-Agap2 3′-UTR. Additionally,Bcl2 and Pten are similar to Agap2.

Additional file 2.

The 3′-UTR point mutationsequences.The 3′-UTR point mutation sequences for Agap2, Bcl2and Pten. Point mutations were introduced by asingle base substitution.

Additional file 3.

Sequencing comparisonresults of MUT-Agap2, Bcl2 and Pten.“Designed MUT-Agap23′-UTR” represents the mutation sequences of the Agap23'-UTR. “Sequencing MUT-Agap2 3′-UTR” represents the sequencing results ofMUT-Agap2 3′-UTR. Additionally, Bcl2 and Ptenare similar to Agap2.

Additional file 4. Full names for the gene abbreviation.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Wang, R., Lin, L., Han, Y. et al. Exosome-delivered miR-153 from Trichinella spiralis promotes apoptosis of intestinal epithelial cells by downregulating Bcl2. Vet Res 54, 52 (2023). https://doi.org/10.1186/s13567-023-01186-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13567-023-01186-6

Keywords

Veterinary Research

ISSN: 1297-9716