Skip to main content
Download PDF

Identification of a novel risk factor for chronic wasting disease (CWD) in elk: S100G single nucleotide polymorphism (SNP) of the prion protein gene (PRNP)

Veterinary Research volume 54, Article number: 48 (2023) Cite this article

Abstract

Prion diseases are fatal and malignant infectious encephalopathies induced by the pathogenic form of prion protein (PrPSc) originating from benign prion protein (PrPC). A previous study reported that the M132L single nucleotide polymorphism (SNP) of the prion protein gene (PRNP) is associated with susceptibility to chronic wasting disease (CWD) in elk. However, a recent meta-analysis integrated previous studies that did not find an association between the M132L SNP and susceptibility to CWD. Thus, there is controversy about the effect of M132L SNP on susceptibility to CWD. In the present study, we investigated novel risk factors for CWD in elk. We investigated genetic polymorphisms of the PRNP gene by amplicon sequencing and compared genotype, allele, and haplotype frequencies between CWD-positive and CWD-negative elk. In addition, we performed a linkage disequilibrium (LD) analysis by the Haploview version 4.2 program. Furthermore, we evaluated the 3D structure and electrostatic potential of elk prion protein (PrP) according to the S100G SNP using AlphaFold and the Swiss-PdbViewer 4.1 program. Finally, we analyzed the free energy change of elk PrP according to the S100G SNP using I-mutant 3.0 and CUPSAT. We identified 23 novel SNP of the elk PRNP gene in 248 elk. We found a strong association between PRNP SNP and susceptibility to CWD in elk. Among those SNP, S100G is the only non-synonymous SNP. We identified that S100G is predicted to change the electrostatic potential and free energy of elk PrP. To the best of our knowledge, this was the first report of a novel risk factor, the S100G SNP, for CWD.

Introduction

Prion diseases are fatal and infectious neurodegenerative disorders caused by a highly aggregated and proteinase K-resistant form of prion protein (PrPSc) converted from normal prion protein (PrPC) encoded by the prion protein gene (PRNP) [1,2,3]. In the Cervidae family, prion disease is called chronic wasting disease (CWD) and has been reported in various Cervidae species, including elk, mule deer, red deer, and sika deer [4,5,6]. Notably, although certain individuals have been infected with CWD, certain individuals have shown resistance to CWD on the farms where CWD occurred [7]. As the cause of this phenomenon, several studies have suggested that genetic polymorphisms of the PRNP gene play a pivotal role in susceptibility/resistance to CWD [8,9,10].

According to Monello et al., there was a correlation between the frequency of the 132L allele and CWD prevalence in 1018 elk sampled from various populations in the USA [11]. In addition, Haley et al. demonstrated that the 132MM genotype was nearly 2 to 3.5 times more prevalent in CWD-positive elk compared to the 132ML and 132LL genotypes, respectively [12]. White et al. also found that the 132L allele was less observed among CWD cases in 559 captive and free-ranging elk from a different geographic region in the USA [13]. However, other studies did not find that the genotype and allele frequencies of the M132L single nucleotide polymorphism (SNP) were associated with susceptibility to CWD in the USA and Korea [14, 15]. In addition, a meta-analysis of the three previous studies also did not identify a relationship between the M132L SNP and susceptibility to CWD in all genetic models [15]. Furthermore, real-time quaking-induced conversion (RT-QuIC) shows that the conversion efficiency of PrPSc of a specific genotype was not high but that the conversion efficiency of PrPSc was high when the genotype of the codon was identical between the template and seed [16]. These discrepancies may be linked to the sample size or CWD strains.

In Korea, more than 12 000 elk are bred, and recently, intermittent CWD cases have been reported there [17,18,19]. The exact cause of CWD is unknown since elk have been banned from importation from Canada since 2000. Since CWD is an extremely infectious disease, investigation of the novel risk factor for CWD is needed for preemptive control of CWD, a national disaster-type disease.

In the present study, to identify novel risk factors for CWD in elk, we investigated genetic polymorphisms of the PRNP gene and compared genotype, allele, and haplotype frequencies between 52 CWD-positive and 196 CWD-negative elk. In addition, we performed a linkage disequilibrium (LD) analysis among PRNP polymorphisms to find the LD relationship among PRNP polymorphisms. Furthermore, we analyzed the 3D structure and electrostatic potential of elk prion protein (PrP) according to the S100G SNP using AlphaFold and the Swiss-PdbViewer 4.1 program [20, 21]. Finally, we investigated the free energy change of elk PrP according to the S100G SNP using I-mutant 3.0 and CUPSAT [22, 23].

Materials and methods

Ethics statements

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jeonbuk National University (IACUC Number: JBNU-2019-0076). All experiments were carried out following the Korea Experimental Animal Protection Act.

Subjects

Brain tissues derived from 248 elk were obtained from 6 animal farms in the Republic of Korea including Chungnam (Geumsan, 61 animals; Hongsung, 19 animals), Gyeongnam (Namhae, 50 animals; Jinju, 77 animals), and Jeonnam (Hampyeong, 2 animals; Gokseong, 39 animals) provinces where CWD has occurred [12]. The breeding scale of each farm is as follows, Chungnam (Geumsan), 61 animals; Gyeongnam (Namhae), 56 animals; Jeonnam (Gokseong), 53 animals; Jeonnam (Hampyeong); 221 animals. The breeding scale of Chungnam (Hongsung) and Gyeongnam (Jinju) was not available. The owners of the farms in Chungnam (Geumsan) and Gyeongnam (Namhae) were the same, however, the epidemiological association (route and source of infection) between each farm was not observed. CWD tests were conducted on all brain samples by the Animal and Plant Quarantine Agency (APQA) in the Republic of Korea using the HerdChek BSE-Scrapie Antigen Kit (IDEXX, USA) and Western blot analysis. Out of the 248 elk, 52 elk (Gyeongnam, 19 animals; Jeonnam, 19 animals (Gokseong, 17 animals; Hampyeong, 2 animals); Chungnam, 14 animals) were diagnosed with CWD.

Genomic DNA

Genomic DNA was isolated from 20 mg of brain tissue using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol.

Genetic analysis of the elk PRNP gene

Polymerase chain reaction (PCR) was conducted to investigate the variations from amino acid 8 to 235 within the open reading frame (ORF) of elk PRNP gene (accession number: FJ590751.1) from the genomic DNA using the forward and reverse gene-specific primers PRNP-F (ATGGTGAAAAGCCACATAGGC) and PRNP-R (ACACTTGCCCCTCTTTGGTA). PCR was performed using DNA Polymerase (Biofact, Daejeon, Republic of Korea) and an S-1000 Thermal Cycler (Bio-Rad, Hercules, California, USA) according to the manufacturer’s protocol. The PCR conditions for the PRNP-F and PRNP-R primers were as follows: 95 °C for 2 min for denaturation; 35 cycles of 94 °C for 45 s, 59 °C for 45 s, and 72 °C for 1 min 30 s; and 1 cycle of 72 °C for 10 min for extension. Detailed information on PCR is described in a previous study [12]. The amplicons were eluted using a PCR Purification Kit (Thermo Fisher Scientific, Bridgewater, New Jersey, USA) and sequenced by an ABI 3730 automatic sequencer (ABI, Foster City, California, USA) on both strands. Sequencing results were visualized by Finch TV software (Geospiza Inc., Seattle, USA), and genotyping of each nucleotide (Q > 40) was performed.

Statistical analysis

Statistical analyses were conducted by SAS version 9.4 (SAS Institute Inc., USA). The differences in genotype and allele distributions of the PRNP gene between CWD-negative and CWD-positive elk were analyzed using the χ2 test and Fisher exact test. The Hardy-Weinberg equilibrium (HWE), haplotype analyses and LD tests were conducted by Haploview version 4.2 (Broad Institute, Cambridge, MA, USA) as previously described [8].

3D structure and electrostatic potential analyses of elk PrP

The 3D structure of elk PrP was predicted by AlphaFold based on machine learning. The confidence of modeling was evaluated by the predicted local distance difference test (pLDDT) score on a scale from 0–100. The predicted structure was visualized by the Swiss-PdbViewer 4.1 program.

Prediction of protein stability changes

Protein stability changes according to S100G were predicted by I-mutant 3.0 and CUPSAT. I-mutant 3.0 estimated protein stability changes based on a support vector machine (SVM) and evaluated the free energy change (DDG) value with positive (increase) and negative (decrease) signs. CUPSAT calculated protein stability changes based on protein environment-specific mean force potentials and evaluated the DDG value with positive (increase) and negative (decrease) signs.

Results

Identification of 23 novel PRNP polymorphisms in elk

To identify polymorphisms of the elk PRNP gene, we performed amplicon sequencing analysis targeting the ORF of the elk PRNP gene. We identified a total of 26 SNP, including 10 synonymous SNP and 16 non-synonymous SNP. Among 26 SNP, 23 SNP were novel SNP, including 8 synonymous SNP and 15 non-synonymous SNP (Figures 1 and 2). We also found c.63C > T, G (V21V), c.312G > A (K104K) and c.394A > T (M132L) SNP reported in elk in previous studies [12].

Figure 1
figure 1

Schematic map of the prion protein (PrP) with single-nucleotide polymorphisms (SNP) of the prion protein gene (PRNP) in elk. * indicates non-synonymous SNP. # indicates previously reported non-synonymous SNP. SP: signal peptide; OPR: octapeptide repeat region.

Full size image
Figure 2
figure 2

Electropherograms of 23 novel SNP of the PRNP gene found in 248 elk. The colors of the peaks designate each base of the DNA sequence (green: adenine; red: thymine; blue: cytosine; black: guanine). The red arrows designate the location of the SNP found in the present study. *indicates non-synonymous SNP. M/M: major homozygote; M/m: heterozygote; m/m: minor homozygote.

Full size image

Identification of a strong association between PRNP SNP and susceptibility to CWD in elk

To investigate the relationship of PRNP SNP with susceptibility to CWD, we compared the genotype, allele and haplotype distributions between 196 CWD-negative and 52 CWD-positive elk. Detailed information on the genotype, allele and haplotype distributions is described in Tables 1 and 2. Notably, the genotype and allele distributions of the c.63C > T, G (V21V), c.298A > G (S100G) and c.408C > T (A136A) SNP were significantly different between CWD-negative and CWD-positive elk. In addition, allele distributions of c.312G > A (K104K), c.384C > T (L128L) and c.501G > A (R167R) were significantly different between CWD-negative and CWD-positive elk. As shown in a previous study, we did not find an association of c.394A > T (M132L SNP) with susceptibility to CWD in elk [12].

Table 1 Comparison of genotype and allele distributions of the prion protein gene (PRNP) between chronic wasting disease (CWD)-negative and CWD-positive elks
Full size table
Table 2 Comparison of haplotype distributions of the prion protein gene (PRNP) between chronic wasting disease (CWD)-negative and CWD-positive elks
Full size table

The most frequently observed haplotype was GGACAAAAAATACAGG (CWD-negative elk: 71.5%; CWD-positive elk: 70.4%), followed by GGACAATAAATACAGG (CWD-negative elk: 16.1%; CWD-positive elk: 13%) and GGGCAAAAAATACAGC (CWD-negative elk: 4.2%; CWD-positive elk: 0%). Notably, the GGGCAAAAAATACAGC and GGACAAAAAATACAGC haplotype distributions were significantly different between CWD-negative and CWD-positive elk (Table 2).

We investigated the LD among the 16 non-synonymous SNP of the elk PRNP gene with r2 values. The detailed LD values are described in Table 3. In the CWD-positive elk, all of the SNP showed a weak LD (r2 < 0.333). In the CWD-negative elk, 11 strong LD were found among 16 non-synonymous SNP. LD distributions were significantly different between CWD-negative and CWD-positive elk.

Table 3 Linkage disequilibrium (LD) among non-synonymous single nucleotide polymorphisms (SNP) of the cervid prion protein gene (PRNP) in elks
Full size table

In silico evaluation of the S100G SNP on elk PrP

First, the 3D structures of wild-type (S100) and mutant (G100) elk PrP were predicted by AlphaFold. Then, the predicted structure was visualized with Swiss-PdbViewer, and the electrostatic potential was analyzed (Figure 3A). Notably, the positive potential of elk PrP with the G100 allele was shrank compared to that of wild-type elk PrP.

Figure 3
figure 3

In silico analyses of elk PrP according to S100G. A Electrostatic potential and 3D structure analysis of elk PrP. The left panel indicates wild-type elk PrP. The right panel indicates elk PrP with the G100 allele. Positive potentials are noted in blue. Negative potentials are drawn in red. B Prediction of protein stability changes using I-mutant 3.0 and CUPSAT. The DDG value indicates the free energy change according to S100G.

Full size image

We estimated the protein stability changes according to S100G by I-mutant 3.0 and CUPSAT (Figure 3B). Notably, S100G was predicted to induce a decrease in the free energy of elk PrP (I-mutant 3.0: − 0.46 kcal/mol; CUPSAT: − 0.32 kcal/mol).

Discussion

In the present study, we found 23 novel SNP of the elk PRNP gene and a high level of genetic diversity (Table 1, Figures 1, 2). However, a previous study using microsatellite analysis has reported that elk have low genetic diversity [24]. Previous studies have reported that genetic diversity of the PRNP gene is correlated to prion resistance and susceptibility. A small number of SNP have been reported in dogs and horses, which are prion-resistant animals [25,26,27]. In contrast, sheep, goats, cattle, deer, and humans, which are prion-susceptible animals, show high genetic diversity for the PRNP gene [8, 28,29,30,31]. This phenomenon may provide clues to explain the high genetic diversity of the elk PRNP gene. Moreover, given that this population was originally imported from Canada, it is possible that the observed phenomenon is a result of its unique history, specific management practices, or animal relocation. Therefore, further investigation of this issue would be highly valuable in the future.

We also identified a strong association between PRNP polymorphisms and susceptibility to CWD in elk (Tables 1 and 2). Among those SNP, the S100G SNP is the only non-synonymous SNP. In addition, c.298A > G (S100G) did not have strong LD in CWD-positive and CWD-negative elk (Table 3). Since the non-synonymous SNP directly affects the structural features of the protein, we generated the template of elk PrP according to the S100G SNP by AlphaFold and analyzed the 3D structure and electrostatic potential (Figure 3A). Although the 3D structure of wild-type elk PrP was not significantly different from that of elk PrP with the G100 allele, notably, the positive charge of elk PrP with the G100 allele was decreased compared to that of wild-type elk PrP. In addition, the free energy of elk PrP with the G100 allele was decreased compared to that of wild-type PrP (Figure 3B). Previous studies have reported that the electrostatic potential of PrP plays an important role in PrP oligomerization [32]. In addition, a large free energy barrier is a crucial factor affecting protein stability, and unstable PrP is related to amyloid propensity [33, 34]. Thus, the S100G SNP was predicted to alter the electrostatic structure of elk PrP and provide a susceptible feature to CWD. Further validation using prion infection in transgenic mice and protein misfolding cyclic amplification (PMCA) and RT-QuIC assays with elk PrP carrying S100G is needed to evaluate the relationship between the S100G SNP and susceptibility to CWD in the future.

CWD is the most potent infectious property among prion diseases [35]. CWD is regarded to be transmitted through direct animal contact or by indirect exposure to contaminated environmental factors [36]. In addition, recent studies have reported that sporadic forms of CWD have emerged in Northern European countries [35, 37]. Furthermore, several cases of transmission by overcoming the interspecies barrier have been reported, and experimental infection of CWD agents caused CWD-related phenotypes in nonhuman primates [38]. In Korea, meat and antlers derived from Cervidae species are frequently consumed for food or oriental medicine. Thus, careful preemptive control of CWD is needed. For the preemptive control of CWD in elk, culling for individuals with CWD-related genotypes is also a good method, and the S100G SNP presented in this study is also proposed as a potential candidate for the construction of a selective breeding system. Since PRNP polymorphisms are related to not only susceptibility to CWD but also modulation of strain selection [39, 40], it is highly desirable to investigate the characteristics of S100G SNP as a novel CWD strain to construct the selective breeding system in the future.

In conclusion, we found 23 novel SNP of the elk PRNP gene. We identified a strong association between PRNP SNP and susceptibility to CWD in elk. S100G SNP is predicted to decrease the electrostatic potential and free energy of elk PrP. To the best of our knowledge, this is the first report of a strong association between the S100G SNP and susceptibility to CWD.

Data availability

All data are available from the corresponding authors upon reasonable request.

References

  1. Prusiner SB (1991) Prion biology and diseases. Science 252:1515–1522. https://doi.org/10.1126/science.1675487

    Article  CAS  PubMed  Google Scholar 

  2. Will RG, Ironside JW (2017) Sporadic and infectious human prion diseases. Cold Spring Harb Perspect Med 7:a024364. https://doi.org/10.1101/cshperspect.a024364

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Kim YC, Won SY, Jeong BH (2021) Altered expression of glymphatic system-related proteins in prion diseases: implications for the role of the glymphatic system in prion diseases. Cell Mol Immunol 18:2281–2283. https://doi.org/10.1038/s41423-021-00747-z

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Benestad SL, Telling GC (2018) Chronic wasting disease: an evolving prion disease of cervids. Handb Clin Neurol 153:135–151. https://doi.org/10.1016/B978-0-444-63945-5.00008-8

    Article  PubMed  Google Scholar 

  5. Haley NJ, Hoover EA (2015) Chronic wasting disease of cervids: current knowledge and future perspectives. Annu Rev Anim Biosci 3:305–325. https://doi.org/10.1146/annurev-animal-022114-111001

    Article  CAS  PubMed  Google Scholar 

  6. Ferreira NC, Charco JM, Plagenz J, Orru CD, Denkers ND, Metrick MA 2nd, Hughson AG, Griffin KA, Race B, Hoover EA, Castilla J, Nichols TA, Miller MW, Caughey B (2021) Detection of chronic wasting disease in mule and white-tailed deer by RT-QuIC analysis of outer ear. Sci Rep 11:7702. https://doi.org/10.1038/s41598-021-87295-8

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. O’Rourke KI, Besser TE, Miller MW, Cline TF, Spraker TR, Jenny AL, Wild MA, Zebarth GL, Williams ES (1999) PrP genotypes of captive and free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) with chronic wasting disease. J Gen Virol 80:2765–2769. https://doi.org/10.1099/0022-1317-80-10-2765

    Article  PubMed  Google Scholar 

  8. Roh IS, Kim YC, Won SY, Jeong MJ, Park KJ, Park HC, Lee YR, Kang HE, Sohn HJ, Jeong BH (2022) First report of a strong association between genetic polymorphisms of the prion protein gene (PRNP) and susceptibility to chronic wasting disease in sika deer (Cervus nippon). Transbound Emerg Dis 69:2073–2083. https://doi.org/10.1111/tbed.14543

    Article  CAS  Google Scholar 

  9. Robinson SJ, Samuel MD, O’Rourke KI, Johnson CJ (2012) The role of genetics in chronic wasting disease of North American cervids. Prion 6:153–162. https://doi.org/10.4161/pri.19640

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Arifin MI, Hannaoui S, Chang SC, Thapa S, Schatzl HM, Gilch S (2021) Cervid prion protein polymorphisms: role in chronic wasting disease pathogenesis. Int J Mol Sci 22:2271. https://doi.org/10.3390/ijms22052271

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Monello RJ, Galloway NL, Powers JG, Madsen-Bouterse SA, Edwards WH, Wood ME, O’Rourke KI, Wild MA (2017) Pathogen-mediated selection in free-ranging elk populations infected by chronic wasting disease. Proc Natl Acad Sci U S A 114:12208–12212. https://doi.org/10.1073/pnas.1707807114

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Haley NJ, Donner R, Henderson DM, Tennant J, Hoover EA, Manca M, Caughey B, Kondru N, Manne S, Kanthasamay A, Hannaoui S, Chang SC, Gilch S, Smiley S, Mitchell G, Lehmkuhl AD, Thomsen BV (2020) Cross-validation of the RT-QuIC assay for the antemortem detection of chronic wasting disease in elk. Prion 14:47–55. https://doi.org/10.1080/19336896.2020.1716657

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. White SN, Spraker TR, Reynolds JO, O’Rourke KI (2010) Association analysis of PRNP gene region with chronic wasting disease in Rocky Mountain elk. BMC Res Notes 3:314. https://doi.org/10.1186/1756-0500-3-314

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Perucchini M, Griffin K, Miller MW, Goldmann W (2008) PrP genotypes of free-ranging wapiti (Cervus elaphus nelsoni) with chronic wasting disease. J Gen Virol 89:1324–1328. https://doi.org/10.1099/vir.0.83424-0

    Article  CAS  PubMed  Google Scholar 

  15. Roh IS, Kim YC, Won SY, Park KJ, Park HC, Hwang JY, Kang HE, Sohn HJ, Jeong BH (2021) Association study of the M132L single nucleotide polymorphism with susceptibility to chronic wasting disease in Korean elk: a meta-analysis. Front Vet Sci. 8:804325. https://doi.org/10.3389/fvets.2021.804325

    Article  PubMed  Google Scholar 

  16. Moore SJ, Vrentas CE, Hwang S, West Greenlee MH, Nicholson EM, Greenlee JJ (2018) Pathologic and biochemical characterization of PrPSc from elk with PRNP polymorphisms at codon 132 after experimental infection with the chronic wasting disease agent. BMC Vet Res 14:80. https://doi.org/10.1186/s12917-018-1400-9

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Roh IS, Kim YC, Kim HJ, Won SY, Jeong MJ, Kang HE, Sohn HJ, Jeong BH (2020) Identification of the prion-related protein gene (PRNT) sequences in various species of the Cervidae family. Mol Biol Rep 47:6155–6164. https://doi.org/10.1007/s11033-020-05697-9

    Article  CAS  PubMed  Google Scholar 

  18. Roh IS, Kim YC, Kim HJ, Won SY, Jeong MJ, Hwang JY, Kang HE, Sohn HJ, Jeong BH (2021) Polymorphisms of the prion-related protein gene are strongly associated with cervids’ susceptibility to chronic wasting disease. Vet Rec. 190:e940. https://doi.org/10.1002/vetr.940

    Article  PubMed  Google Scholar 

  19. Sohn HJ, Kim JH, Choi KS, Nah JJ, Joo YS, Jean YH, Ahn SW, Kim OK, Kim DY, Balachandran A (2002) A case of chronic wasting disease in an elk imported to Korea from Canada. J Vet Med Sci 64:855–858. https://doi.org/10.1292/jvms.64.855

    Article  PubMed  Google Scholar 

  20. Fersht AR (2021) AlphaFold - a personal perspective on the impact of machine learning. J Mol Biol. 433:167088. https://doi.org/10.1016/j.jmb.2021.167088

    Article  CAS  PubMed  Google Scholar 

  21. Guex N, Peitsch MC, Schwede T (2009) Automated comparative protein structure modeling with SWISS-MODEL and Swiss-PdbViewer: a historical perspective. Electrophoresis 30:S162-173. https://doi.org/10.1002/elps.200900140

    Article  PubMed  Google Scholar 

  22. Parthiban V, Gromiha MM, Schomburg D (2006) CUPSAT: prediction of protein stability upon point mutations. Nucleic Acids Res 34:239–242. https://doi.org/10.1093/nar/gkl190

    Article  CAS  Google Scholar 

  23. Capriotti E, Fariselli P, Casadio R (2005) I-Mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. Nucleic Acids Res 33:306–310. https://doi.org/10.1093/nar/gki375

    Article  CAS  Google Scholar 

  24. Polziehn RO, Hamr J, Mallory FF, Strobeck C (2000) Microsatellite analysis of North American wapiti (Cervus elaphus) populations. Mol Ecol 9:1561–1576. https://doi.org/10.1046/j.1365-294x.2000.01033.x

    Article  CAS  PubMed  Google Scholar 

  25. Kim DJ, Kim YC, Kim AD, Jeong BH (2020) Novel polymorphisms and genetic characteristics of the prion protein gene (PRNP) in dogs-a resistant animal of prion disease. Int J Mol Sci 21:4160. https://doi.org/10.3390/ijms21114160

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Kim YC, Won SY, Do K, Jeong BH (2020) Identification of the novel polymorphisms and potential genetic features of the prion protein gene (PRNP) in horses, a prion disease-resistant animal. Sci Rep 10:8926. https://doi.org/10.1038/s41598-020-65731-5

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Kim YC, Jeong BH (2018) The first report of polymorphisms and genetic characteristics of the prion protein gene (PRNP) in horses. Prion 12:245–252. https://doi.org/10.1080/19336896.2018.1513316

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Adeola AC, Bello SF, Abdussamad AM, Mark AI, Sanke OJ, Onoja AB, Nneji LM, Abdullahi N, Olaogun SC, Rogo LD, Mangbon GF, Pedro SL, Hiinan MP, Mukhtar MM, Ibrahim J, Saidu H, Dawuda PM, Bala RK, Abdullahi HL, Salako AE, Kdidi S, Yahyaoui MH, Yin TT (2022) Scrapie-associated polymorphisms of the prion protein gene (PRNP) in Nigerian native goats. Gene 855:147121. https://doi.org/10.1016/j.gene.2022.147121

    Article  CAS  PubMed  Google Scholar 

  29. Kim SK, Kim YC, Won SY, Jeong BH (2019) Potential scrapie-associated polymorphisms of the prion protein gene (PRNP) in Korean native black goats. Sci Rep 9:15293. https://doi.org/10.1038/s41598-019-51621-y

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Haley N, Donner R, Merrett K, Miller M, Senior K (2021) Selective breeding for disease-resistant PRNP variants to manage chronic wasting disease in farmed whitetail deer. Genes 12:1396. https://doi.org/10.3390/genes12091396

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Mead S, Lloyd S, Collinge J (2019) Genetic factors in mammalian prion diseases. Annu Rev Genet 53:117–147. https://doi.org/10.1146/annurev-genet-120213-092352

    Article  CAS  PubMed  Google Scholar 

  32. Wang B, Lou Z, Zhang H, Xu B (2016) Effect of the electrostatic surface potential on the oligomerization of full-length human recombinant prion protein at single-molecule level. J Chem Phys. 144:114701. https://doi.org/10.1063/1.4943878

    Article  CAS  PubMed  Google Scholar 

  33. Naganathan AN, Doshi U, Fung A, Sadqi M, Munoz V (2006) Dynamics, energetics, and structure in protein folding. Biochemistry 45:8466–8475. https://doi.org/10.1021/bi060643c

    Article  CAS  PubMed  Google Scholar 

  34. Singh J, Kumar H, Sabareesan AT, Udgaonkar JB (2014) Rational stabilization of helix 2 of the prion protein prevents its misfolding and oligomerization. J Am Chem Soc 136:16704–16707. https://doi.org/10.1021/ja510964t

    Article  CAS  PubMed  Google Scholar 

  35. Rivera NA, Brandt AL, Novakofski JE, Mateus-Pinilla NE (2019) Chronic wasting disease in cervids: prevalence, impact and management strategies. Vet Med 10:123–139. https://doi.org/10.2147/VMRR.S197404

    Article  Google Scholar 

  36. Otero A, Velasquez CD, Aiken J, McKenzie D (2021) Chronic wasting disease: a cervid prion infection looming to spillover. Vet Res 52:115. https://doi.org/10.1186/s13567-021-00986-y

    Article  PubMed  PubMed Central  Google Scholar 

  37. Guere ME, Vage J, Tharaldsen H, Kvie KS, Bardsen BJ, Benestad SL, Vikoren T, Madslien K, Rolandsen CM, Tranulis MA, Roed KH (2021) Chronic wasting disease in Norway-A survey of prion protein gene variation among cervids. Transbound Emerg Dis 69:e20–e31. https://doi.org/10.1111/tbed.14258

    Article  CAS  PubMed  Google Scholar 

  38. Marsh RF, Kincaid AE, Bessen RA, Bartz JC (2005) Interspecies transmission of chronic wasting disease prions to squirrel monkeys (Saimiri sciureus). J Virol 79:13794–13796. https://doi.org/10.1111/tbed.14258

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Otero A, Duque Velasquez C, McKenzie D, Aiken J (2022) Emergence of CWD strains. Cell Tissue Res. https://doi.org/10.1007/s00441-022-03688-9

    Article  PubMed  PubMed Central  Google Scholar 

  40. Moore J, Tatum T, Hwang S, Vrentas C, West Greenlee MH, Kong Q, Nicholson E, Greenlee J (2020) Novel strain of the chronic wasting disease agent isolated from experimentally inoculated elk with LL132 prion protein. Sci Rep 10:3148. https://doi.org/10.1038/s41598-020-59819-1

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C1013213, 2022R1C1C2004792). This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (2017R1A6A1A03015876, 2021R1A6A3A01086488). This research was supported by APQA, Ministry for Agriculture, Food and Rural Affairs (B-1543085-22-24-01).

Funding

National Research Foundation of Korea,2021R1A2C1013213,Byung-Hoon Jeong,2022R1C1C2004792,Yong-Chan Kim,2017R1A6A1A03015876,Byung-Hoon Jeong,2021R1A6A3A01086488,Yong-Chan Kim,APQA,Ministry for Agriculture,Food and Rural Affairs,B-1543085-22-24-01,Hyun-Joo Sohn

Author information

Author notes

  1. Yu-Ran Lee and Yong-Chan Kim contributed equally to this work.

Authors and Affiliations

  1. Reference Laboratory for CWD, Foreign Animal Disease Division, Animal and Plant Quarantine Agency, Gimcheon, 39660, Republic of Korea

    Yu-Ran Lee, Kyung-Je Park, Hoo-Chang Park, In-Soon Roh, Hae-Eun Kang & Hyun-Joo Sohn

  2. Department of Biological Sciences, Andong National University, Andong, 36729, Republic of Korea

    Yong-Chan Kim

  3. Korea Zoonosis Research Institute, Jeonbuk National University, Iksan, 54531, Republic of Korea

    Sae-Young Won, Min-Ju Jeong & Byung-Hoon Jeong

  4. Department of Bioactive Material Sciences and Institute for Molecular Biology and Genetics, Jeonbuk National University, Jeonju, 54896, Republic of Korea

    Sae-Young Won, Min-Ju Jeong & Byung-Hoon Jeong

Authors
  1. Yu-Ran Lee
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yong-Chan Kim
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Sae-Young Won
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Min-Ju Jeong
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kyung-Je Park
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hoo-Chang Park
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. In-Soon Roh
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Hae-Eun Kang
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Hyun-Joo Sohn
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Byung-Hoon Jeong
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Y-RL, Y-CK, H-JS and B-HJ conceived and designed the experiment. Y-RL, Y-CK, S-YW, M-JJ, K-JP, H-CP and I-SR performed the experiments. Y-CK, S-YW, H-EK and B-HJ analyzed the data. Y-RL, Y-CK, H-JS and B-HJ wrote the paper. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Hyun-Joo Sohn or Byung-Hoon Jeong.

Ethics declarations

Ethics approval and consent to participate

All experimental procedures were approved by the Institutional Animal Care and Use Committee of Jeonbuk National University (IACUC Number: JBNU-2019–0076). All experiments were carried out following the Korea Experimental Animal Protection Act.

Competing interests

The authors declare that they have no competing interests.

Additional information

Handling editor: Vincent Béringue

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Lee, YR., Kim, YC., Won, SY. et al. Identification of a novel risk factor for chronic wasting disease (CWD) in elk: S100G single nucleotide polymorphism (SNP) of the prion protein gene (PRNP). Vet Res 54, 48 (2023). https://doi.org/10.1186/s13567-023-01177-7

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13567-023-01177-7

Keywords

Veterinary Research

ISSN: 1297-9716