Skip to main content

Table 1 Primer sequences and the names of PCR products and generated vectors used in this study

From: Stable trimer formation of spike protein from porcine epidemic diarrhea virus improves the efficiency of secretory production in silkworms and induces neutralizing antibodies in mice

Primer name Sequence (5ʹ to 3ʹ) PCR product name Vector name
S1-1332-noATG-F ACGCCTTTAATTTACTTCTGGTTGTTCTTAC PEDV/S(1–1332)-XhoI pENTR11L21-PEDV/S(1–1332) + TEVdH8S
S1-1332-stopXhoI-F GGGGCTCGAGATAAAAATAATCAACCAAACCCAC
S1-1332-F AAGCACAAAGGAAGCTAGACCCAGCTTTCTTGTACAAAG PEDV/S(1–1332)-Tags pENTR11L21-PEDV/S(1–1332) + Tags
S1-1332-R CATGCTGCCCCCTCCATGATGATGGTGATGATGCTTTTCG
S1-1320-F TCGAGTGCAGGCGAAAACCTGTACTTCC PEDV/S(1–1320)-Tags pENTR11L21-PEDV/S(1–1320) + Tags
S1-1320-R GATATATGTCTCAACTCGGTTGAGCCACTCAAGG
PEDVS-TEV-F TCGAGTGCAGGCGAAAACCTGTACTTCC PEDV/S(1–1320)-Tags-gib pENTR11L21-PEDV/S(1–1320) + CMP + Tags
S+CMP-R GATATATGTCTCAACTCGGTTGAGCCAC
CMP-F CCGAGTTGAGACATATATCGAAGAAGACCCGTGTGAGTGTAAAAGC CMP
CMP-R GGTTTTCGCCTGCACTCGAGATAATTTTATTCTCCAGCGCTTCAATGCG