Skip to main content

Table 1 Primers used in this study

From: SYNCRIP facilitates porcine parvovirus viral DNA replication through the alternative splicing of NS1 mRNA to promote NS2 mRNA formation

Primers Sequences (5′–3′) Vectors
NS1-F CACTCGAGATGGATTACAAGGATGACGACGATAAGGCAGCGGGAAACACTTACTC pCI-neo
NS1-R GGCTCTAGATTATTCAAGGTTTGTTGTGGGTG
p-NS1-F CACTCGAGATGGCAGCGGGAAACACTTAC pEGFP-N1
p-NS1-R GGCGAATTCGCATTCAAGGTTTGTTGTGGGTG
NS2-F CACTCGAGATGGCAGCGGGAAACACTTAC pEGFP-N1
NS2-R GTCGGATCCGTCCAAAGCAGGCTCTTATG
p-NS2-F CAGCTAGCATGGCAGCGGGAAACACTTAC pCDH-EF1-MCS-T2A-Puro
p-NS2-R GTCGCGGCCGCGTCCAAAGCAGGCTCTTATG
VP1-F CACTCGAGATGGCGCCTCCTGCAAAAAGAGCAAGAGGACTAACTCTACCAGGATAC pEGFP-N1
VP1-R GTCGGATCCGTGTATAATTTTCTTGGTATAAG
VP2-F CACTCGAGATGAGTGAAAATGTGGAAC pEGFP-N1
VP2-R GTCGGATCCGTGTATAATTTTCTTGGTATAAG
SYNCRIP-F GGCGTCGACTCATGGCTACAGAACATGTTAATGGA pGEX-4 T-1
SYNCRIP-R GGCGCGGCCGCTTATTGTAACAGGTCAGGACCGG
p-SYNCRIP-F GGCCTCGAGATGGCTACAGAACATGTTAATGGA pCDNA3.0
p-SYNCRIP-R GGCTCTAGATTAATGGTGATGGTGATGATGGGTGGAGGCTTGTAACAGGTCAGGACCGG
  1. Restriction enzyme sequences are underlined.