Skip to content

Advertisement

  • Research article
  • Open Access

Identification and assessment of virulence of a natural reassortant of infectious bursal disease virus

Veterinary Research201849:89

https://doi.org/10.1186/s13567-018-0586-y

  • Received: 30 June 2018
  • Accepted: 27 August 2018
  • Published:

Abstract

Infectious bursal disease virus (IBDV) is one of the most important immunosuppressive viral agents in poultry production. Prophylactic vaccinations of chicken flocks are the primary tool for disease control. Widely used immunoprophylaxis can, however, provide high pressure which contributes to the genetic diversification of circulating viruses, e.g. through reassortment of genome segments. We report the genetic and phenotypic characterization of a field reassortant IBDV (designated as Bpop/03) that acquired segment A from very virulent IBDV and segment B from classical attenuated D78-like IBDV. Despite the mosaic genetic make-up, the virus caused high mortality (80%) in experimentally infected SPF chickens and induced lesions typical of the acute form of IBD. The in vivo study results are in contrast with the foregoing experimental investigations in which the natural reassortants exhibited an intermediate pathotype, and underline the complex nature of IBDV virulence.

Introduction

Infectious bursal disease virus (IBDV) is a double-stranded RNA virus which belongs to the Avibirnavirus genus, Birnaviridae family. The virus possesses a bi-segmented genome (segments A and B) within a non-enveloped icosahedral capsid and is the causative agent of an immunosuppressive disease of young chickens [1]. It is commonplace in nature that viruses with segmented genomes may exchange genetic material if they infect one cell at the same time. Natural reassortants of IBDV have already been reported from Asia [2, 3], South America [4], North America [5], Africa [6, 7] and Europe [8].

The genome of IBDV encodes for 5 viral proteins. VP2 is the major structural viral protein that builds the viral capsid [9] and contains an antigenic domain responsible for inducing secretion of neutralization antibodies [10]. The IBDV encodes its own RNA-dependent RNA polymerase designated VP1 that is responsible for the genome replication, transcription [11] and probably translation of virus protein [12]. The VP2, VP1 and another structural protein VP3 together play a crucial role in the morphogenesis and encapsidation of the viral genome [13]. In turn, the VP4 protein is a viral protease [14] that effects post-translational cleavage of the polyprotein (VP2–VP4–VP3) and takes part in the maturing of the VP2 peptide [15]. VP5 is a non-structural protein that cooperates in releasing of virus progeny from infected cells both through the non-lytic mechanism during the early phase of infection [16] and the activation of cell apoptosis in later stages by interacting with mitochondrial ionic channels (VDAC2) [17].

IBDV serotype 1 is pathogenic to chickens but the virulence among this group can vary. The very virulent IBDV (vvIBDV) are the most pathogenic and can cause mortality up to 100% in SPF chickens. Classical and US variant strains are less virulent but they are immunosuppressive. The attenuated strains are generated by passaging different virus pathotypes on cell culture or SPF chicken embryos resulting in loss of pathogenic capacity [1]. Such strains are used in commercial live vaccines.

IBD has been reported in Poland since the end of the 1970s when the first epidemic caused by classical strains occurred. At the end of 1991, the first cases of acute IBDV were diagnosed. Infections with very virulent IBDV have caused economic losses due to high mortality rates. Afterwards, new immunoprophylaxis programmes were implemented which reduced the number of vvIBDV infections, but nevertheless IBD was still affecting polish poultry production [18]. Some of the Polish classical and very virulent strains have been antigenically and molecularly characterized [19] but since then there has been a lack of information about the recent field IBD situation in this part of Europe.

The aim of this study was a genetic and pathotypic characterization of a reassortant IBD virus detected in Poland.

Materials and methods

Samples

Samples were collected in 2003 from vaccinated broiler chickens (Nobilis D78, MSD Netherlands) with signs of immunosuppressive disorder. Ten bursa samples were collected for laboratory examinations. The tissue samples were homogenised in phosphate buffered saline (4 mL PBS per gram tissue) and centrifuged at 4 °C 3500 g for 15 min. The fluid obtained was collected and stored (below −65 °C) for further investigations.

Virus isolation

The virus isolation was conducted on 10-day-old SPF embryonated eggs using the chorioallantoic membrane route (CAM) [20]. The fluid was filtered through a 0.45 µm membrane before inoculation. After 7-day incubation the embryos and chorioallantoic membrane were harvested, homogenised and stored below −65 °C.

Detection and identification of IBDV

The total RNA was extracted using an RNeasy Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The presence of the IBD virus in bursal and embryo-derived samples was confirmed with adherence to a previously published rRT-PCR protocol [21]. Identification of the IBDV genotype was performed according to a previously described RT-PCR aimed at the hypervariable domain of VP2 peptide [22]. The partial sequence of VP1 peptide was amplified with primers designed to the nucleotide sequence of D6948 strain (GenBank Accession number AF240687, Table 1) which are complementary to the 5′ two-thirds of segment B. The RT-PCR reaction was performed in a 25 μL volume of reaction mixture using the one-step RT-PCR kit (Qiagen, Germany). The reverse transcription step was conducted at 50 °C for 30 min and PCR was performed under the following conditions: initial denaturation at 95 °C for 15 min, followed by 35 cycles of amplification (denaturation 94 °C for 40 s, annealing at 58 °C for 1 min and elongation at 72 °C for 1 min). Final extension was conducted at 72 °C for 7 min. The PCR products obtained were sequenced in both directions by a commercial service (Genomed, Poland).
Table 1

Primer sequences used in this study for the amplification of a partial sequence of VP1 gene

Primer

Sequence (5′→ 3′)

Nucleotide position according to D6948 strain (AF240687)

Size of amplicon (bp)

 SB1F

GTGGAAGAACTCCTGATCCCTAA

193–215

943

 SB1R

GATGGAGCTGACCATATGTT

1117–1136

 SB2F

AACAAGAAGAAGCTGCTCAGC

1006–1026

854

 SB2R

GATCCCAAGATCTTTGCTGTA

1840–1860

Nucleotide sequence and analysis

Molecular characterization and phylogenetic analysis was performed in MEGA 6 [23]. The nucleotide and amino acid sequences were aligned with the ClustalW algorithm. Phylogenetic trees were constructed using the neighbour-joining method with 1000 replicates. A bootstrap value over 70 was considered reliable for the tree topology.

Full-length sequencing of genomic segments by high-throughput sequencing

The IBDV virus suspension was centrifuged at 3500 g for 5 min at 4 °C and filtered through a 0.45 µm membrane (Sartorius, Germany). For nuclease treatment 180 µL of virus supernatant was incubated for 30 min at 37 °C with the addition of 40 units of DNase I (Turbo DNase, Invitrogen, Lithuania) and 20 units of ribonuclease (RNase One, Promega, USA). Afterwards, TRI Reagent extraction of total RNA was conducted using a Direct-zol RNA MiniPrep Kit (Zymo Research, USA) according to the supplier’s instructions. The eluted RNA was subsequently subjected to reverse transcription with the use of the SuperScript IV First-Strand Synthesis System (Invitrogen, Lithuania) and random primers.

The libraries were created using the Ilumina Nextera XT DNA Library Preparation Kit according to the manufacturer’s protocol and afterwards were sequenced using the MiSeq System (Ilumina, USA) with 2 × 300 paired-end reads. The sequences obtained were first mapped using BLAST analysis with the NCBI database in order to remove host-derived sequences (Gallus gallus). The remaining sequences were de novo assembled into contigs using the SPAdes genome assembler (version 3.11.1) [24].

Pathogenicity in chickens

Animal experiments were carried out in accordance with the requirements and authorization of the local ethical commission (Permit no. 87/2012). The D78 (Nobilis, Intervet, Netherlands) and 75/11 were used as a reference for attenuated and typical very virulent strains. Before the animal trial, the 75/11 strain was characterised genetically (partial sequence of VP2: KX759595 and VP1: KX759549) and pathotypically (60% mortality in 5-week old SPF chickens). Based on the OIE standards [20], it was classified as vvIBDV (data not published). Forty five-week-old SPF-layers (White Leghorn, Valo BioMedia, Germany) were divided into 4 groups (10 birds/group). Birds from groups 1 and 2 were intraocularly inoculated with 104 EID50/0.1 mL of Bpop/03 virus suspension (the reassortant strain) and 75/11 virus (vvIBDV strain), respectively. Chickens from group 3 were inoculated with 1 dose of vaccine D78 strain (attenuated IBDV control) and the 4th group was given saline buffer and served as a normal control group. Birds were housed in HEPA-filtered isolators (Montair Andersen B.V., Holland) for 10 days. All chickens were observed daily. All dead or euthanized birds were examined at necropsy and the bursae of Fabricius (BF) were taken for further analysis (histopathology, molecular characterisation, and calculation of bursa to bodyweight (B-BW) index).

Histopathology

Half of each bursa was fixed in 10% phosphate-buffered formalin. In further proceedings the tissues were embedded in paraffin, sectioned and stained using haematoxylin and eosin. The preparations were microscopically examined and evaluated for histopathological abnormalities according to the criteria described by Jackwood et al. [5].

Statistical analysis

The B-BW indexes obtained from each experimental group versus the control group were compared by means of the Mann–Whitney U test, using the social science statistics on-line calculator [25]. To assess if differences in mortality between groups of chickens infected with typical and reassortant IBDV are statistically significant, the Chi square (χ2) test was used. The results with P < 0.05 were recognised as statistically significant.

Identification of concomitant pathogens

In order to reveal the presence of any concomitant pathogens, next-generation sequencing of extracted total DNA and RNA in Bpop/03 samples were performed. The total DNA was purified using a QIAamp DNA Mini kit (Qiagen, Germany) in accordance with the manufacturer’s instructions. The purification of total RNA was described in the previous subsection.

Results

Detection of IBDV

The rRT-PCR reaction confirmed the presence of IBDV in the examined flock and the presence of virus in inoculated SPF embryos. Further identification with conventional RT-PCR, sequencing and BLAST searches of partial sequences of both segments revealed that the analysed VP2 gene sequence has high nucleotide identity to the very virulent D6948 strain (Accession Number AF240687) and VP1 gene sequence to the cell culture–adapted attenuated 903/78 strain (JQ411013).

Sequence analysis

The nearly-complete consensus genome sequence of the Bpop/03 isolate obtained by NGS technology was submitted to GenBank (Accession Numbers: segment A—MH545934, segment B—MH545935). The sequences were aligned using the BLAST tool with the NCBI database. Most of the available IBDV sequences were retrieved and used for further molecular analysis (listed in Table 2). The alignment of both segment sequences confirmed the reassortant nature of the Bpop/03 isolate. The comparison of segment A and B nucleotide sequences revealed 99.1% similarity to the European vvIBDV strain D6948 and 99.3% similarity to the attenuated strain 903/78.
Table 2

List of IBDV’s used in phylogenetic analysis

IBDV strain

Origin

Pathotype/serotype

Accession number

Segment A

Segment B

02015.1

Venezuela

Reassortant

AJ879932

AJ880090

100056

France

Reassortant

KU2345528

KU2345529

150124/1.1

Algeria

Reassortant

MF969105

MF969106

150144/5.1

Algeria

Reassortant

MF969115

MF969116

23/82

UK

Serotype 2

AF362773

AF362774

88180

Ivory Coast

Very virulent

AM111353

AM111354

89163

France

Very virulent

HG974563

HG974564

903/78

Hungary

Attenuated

AF362773

JQ411013

9109

USA

Classical

AY462027

AY459321

94432

France

Very virulent

AM167550

AM167551

BD 3/99

Bangladesh

Very virulent

AF362770

AF362776

CA-D495

USA

Reassortant

JF907703

JF907704

CA-K785

USA

Reassortant

JF907702

JF907705

Cro-Ig/02

Croatia

Very virulent

 EU184685

 EU184686

Cu-1

Germany

Attenuated

D00867

AF362775

D6948

Netherlands

Very virulent

AF240686

AF240687

D78

Nobilis

Attenuated

AF499929

EU162090

Edgar

USA

Classical

AY462026

AY918949

Faragher 52/70

UK

Classical

HG974565

HG974566

GLS

USA

Variant

AY368653

AY368654

Gt

China

Attenuated

DQ403248

DQ403249

Gx

China

Reassortant

AY444873

AY705393

GX-NN-L

China

Reassortant

JX134485

JX134486

Harbin-1

China

Reassortant

EF517528

EF517529

HBDY-1

China

Classical

KX592158

KX592159

HK46

China

Very virulent

AF092943

AF092944

HLJ-0504

China

Reassortant

GQ451330

GQ451331

HN

China

Reasortant

KC109816

KC109815

HuB-1

China

Very virulent

KF589805

GQ449693

HuN11

China

Reassortant

LM651367

LM651368

IBD13HeB01

China

Reassortant

KP676467

KP676468

Irwin Moulthrop

USA

Classical

AY029166

AY029165

K669

USA

Reassortant

JN585293

JN411134

ks

Israel

Very virulent

DQ927042

DQ927043

KZC-104

Zambia

Reassortant

AB368968

AB368969

Lukert

USA

Classical

AY918948

AY918947

NB

China

Very virulent

EU595667

EU595673

OH

USA

Serotype 2

U20950

OKYM

Japan

Very virulent

D49706

D49707

PA/00924/14

USA

Serotype 2

KP642112

KP642111

SD10LY01

China

Very virulent

KF569803

KF569804

SH95

China

Reassortant

AY134874

AY134875

SH99

China

Very virulent

LM651365

LM651366

T09

Nigeria

Very virulent

AY099456

AY099457

Tasik

Indonesia

Very virulent

AF322444

AF322445

TL2004

China

Reasortant

DQ088175

DQ118374

UK661

UK

Very virulent

AJ318896

AJ318897

UPM04/190

Malaysia

Very virulent

KU958716

KU958717

Variant E

USA

Variant

AF133904

AF133905

Winterfield 2512

Cevac

Attenuated

AF083092

ZJ2000

China

Reassortant

AF321056

DQ166818

The deduced amino acid sequence of segment A exhibited a profile typical for very virulent strains with the presence of four specific alterations–one each in the VP5 (F30) and VP2 proteins (L324) and two in VP3 (M778, I856) (Table 3). The first changed residue is located within the VP5 N-terminal domain that is responsible for the interaction with voltage-dependent anion channel 2 (VDAC2) [17] but without further investigation it is difficult to anticipate its impact on the activation of cell apoptosis process. However, the presence of leucine residue at position 324 leads to a loss of IBDV binding capacity with Mab 8 [26]. Finally, the role of the two changes within VP3 protein in IBDV virulence is unknown. The VP1 protein sequence comprised amino acids characteristic for attenuated strains with only one change at position 24 (A → V) and there is no information about the function of this region of VP1 in viral replication.
Table 3

Amino acid differences between typical vvIBDV (D6948, 89163), attenuated strain (D78) and Polish reassortant strain (Bpop/03)

The deduced amino acid sequence of D6948 was used as a reference. Amino acid residues identical to reference strain were indicated by dots (.).

The phylogenetic analysis also confirmed the different origins of both segment sequences. Based on the sequences of segment A, the 51 representatives of different geno- and serotypes of IBDV were clustered into three distinct branches designated as (i) serotype 2, (ii) very virulent and (iii) classical, variant and attenuated IBDV (Figure 1A). The Bpop/03 was found to be closely related to typical vvIBDV strains originating in Europe (D6948, 89 163 and UK661) and Asia (TASIK, Gx and OKYM). However the phylogenetic tree of segment B revealed that Bpop/03 formed a cluster with classical, variant and attenuated strains. Moreover the studied isolate was clustered on one branch with attenuated strains such as Winterfield 2512, Cu-1 and D78 (100% bootstrap).
Figure 1
Figure 1

Phylogenetic tree deduced from the full-length genome segment A (A) and B (B) of representative IBDV strains using neighbour joining methods (1000 replicates). Red dot—polish reassortant strain, green dot—earlier identified reassortant strain.

Pathogenicity

The infection of SPF chickens revealed the high pathogenicity of the Bpop/03 strain: 8 out of 10 SPF chickens died between 3 and 9 days post-infection (dpi). From the second day onwards, typical signs of IBD were observed, including ruffled feathers, depression and watery diarrhea. At necropsy, ecchymotic haemorrhages in the enlarged bursa of Fabricius, breast and thigh muscles and at the mucosal lining of the proventriculus, swollen spleens with punctate clusters of lymphoid tissue and swollen kidneys with visible tubule structure were observed (Figure 2). The bursae of chickens that died between 3 and 6 dpi were enlarged but on the 9th and 10th dpi the organ exhibited severe atrophy. Mortality in the control group inoculated with the reference very virulent IBDV reached 60% and chickens exhibited macroscopic lesions similar to those observed for the Bpop/03 strain. The differences in mortality rates as well as in B-BW ratios at days 9 and 10 post-infection between groups of chickens infected with Bpop/03 and 75/11 IBDV were not statistically significant. In contrast, B-BW indexes of both of these groups were found to be statistically significantly lower than those of the normal and D78 control groups (P < 0.05). No clinical symptoms or gross bursal lesions were observed in the D78 and normal control groups. Detailed results of the pathogenicity experiment conducted are presented in Table 4. Moreover the de novo next-generation sequencing showed the absence of any concomitant bacteria or virus in the investigated samples.
Figure 2
Figure 2

Macroscopic changes observed at necropsy in chickens infected with reassortant strain (Bpop/03). A Bursa of Fabricius and kidneys; B spleen; C proventriculus.

Table 4

Results of in vivo IBDV virulence to SPF chickens

Group no.

IBDV strain

Mortality (%)

B-BW index \(\bar{x}\) ± SD

Histopathologic lesion scoresc

3–5 dpi

10 dpi

1

Bpop/03 reassortant

8/10

(80)

4.53 ± 1.97

n = 6

1.43 ± 0.61b

n = 4

4, 4, 4, 4, 4, 4, 4, 4, 4, 4

2

75/11 vvIBDV control

6/10

(60)

5.73 ± 1.77

n = 6

1.45 ± 0.21

n = 4

4, 4, 4, 4, 4, 4, 2, 4, 4, 4

3

D78 attenuated IBDV control

0/10

(0)

nd

3.45 ± 1.09

n = 10

1, 2, 2, 2, 2, 2, 2, 1, 2, 2

4

Normal control

0/10

(0)

4.70 ± 0.19a

n = 5

5.44 ± 0.29

n = 5

1, 0, 0, 0, 0, 0, 0, 1, 0, 0

aFrom chickens euthanized at 3 dpi.

bFrom chickens dead at 9 dpi or euthanized at 10 dpi.

cAccording to Jackwood et al. [5], \(\bar{x}\), arithmetic mean; SD: standard deviation; nd: not determined.

Histopathology

Histopathological examination of the collected bursae of Fabricius from groups 1–3 indicated differences in the severity of microscopic lesions. The group inoculated with the vaccine D78 strain mainly caused low and moderate depletion of lymphatic follicles and hyperplasia of the tunica muscularis (Figure 3B). Bursa tissues microscopic alterations in groups challenged with Bpop/03 and 75/11 had a similar intensity. In birds found dead in the early phase of infection the lesions were mainly associated with the infiltration of inflammatory cells (heterophils and macrophages) in the tunica muscularis and interstitial connective tissue and depletion or necrosis of medullary and cortical regions of the lymphatic follicles due to the degeneration of lymphoid cells (Figures 3C and E). On the contrary, the bursal tissue collected from euthanized birds was characterized by the absence of lymphoid follicles due to necrosis, atrophy or fibrosis (Figures 3D and F).
Figure 3
Figure 3

Differences in the severity of bursa of Fabricius macroscopic lesions in examined groups. A Normal group, B positive classic IBDV (D78) control group, C very virulent (75/11) control group at 3 dpi, D same group at 10 dpi, E Reassortant (Bpop/03) group at 3 dpi, and F same group at 10 dpi. The magnification is represented by the black band (×50).

In the microscopic examination of the mock-inoculated control the normal histological structure of the BF was recorded (Figure 3A) and only two birds showed a slight loss of lymphoid cells in the medulla of the lymphatic follicles.

Discussion

Reassortment is one of the mechanisms of genetic diversity characteristic of viruses with segmented genomes. To emphasize the role of reassortment in virus genetic variability it is worth bringing up the example of influenza A virus, which each year brings new epidemiological threats to humans and animals [27]. The first IBDV reassortants from Venezuela were reported over a dozen years ago [4], but since then more such reassortant viruses have been identified all over the world. The results of investigations mostly revealed the exchange of genome segments between different pathotypes representing viruses of serotype 1 [1, 2, 6], but inter-serotype reassortants were also identified [5, 8].

The virulence of IBDV is a complex mechanism attributed to different components of the viral genome. Several mosaic IBDV constructed in vitro revealed the contribution of both segments A and B to virulence [2831]. So far, most of the natural reassortant IBDV reported have exhibited intermediate virulence between very virulent and classical pathotype strains [4, 32].

To our knowledge, this study is the first report on the detection of new reassortant infectious bursal disease virus in Eastern Europe. Despite shuffling of genomic segments originating from two parental strains with distinct pathotypes (very virulent and classical cell-culture adapted), the new IBDV strain has inherited high virulence and represents a very virulent phenotype based on the established in vivo criteria [20]. The Bpop/03 IBDV strain caused 80% mortality in SPF chickens (indicative of high virulence), the birds had typical signs of IBD and post-mortem examinations revealed macro- and microscopic abnormalities in multiple organs including extensive lesions in the bursa of Fabricius. The presence of concomitant pathogens was rejected in the face of results from de novo high-throughput sequencing. Moreover, high-throughput sequencing did not provide evidence of mixed infection with other IBDV and therefore we assume that the investigated virus is a natural very virulent/attenuated reassortant that has retained high virulence. New IBDV strains that have preserved their pathogenicity despite the reassortment have been recently described [3, 7]. Li et al. [3] associated the preserved pathogenicity of the Chinese HLJ0504 strain with its novel segment B with unknown origin. Another two reassortants (150124 and 150244) from Algeria also exhibited comparable virulence to a very virulent reference strain (89163). In this case, the authors attributed the phenotype to the amino acid changes in the VP1 protein, but the fact is that both strains also possess several alterations of the VP5 protein that could modify its function. This part of the IBDV genome is quite conserved and plays a major role in IBDV virulence [33]. Sequence analysis of segment A of Bpop/03 revealed the presence of four unique residues within VP5 (F30), VP3 (M778, I856) and VP1 (V24). Because the molecular markers of IBDV virulence have not been defined, more investigations using reverse genetics are needed to explore the role of this mutation.

Despite the high nucleotide homology to the D78 strain (99.1%), it is unlikely that segment B of the reassortant IBDV was derived from a commercial vaccine seed because the genetic changes are too extensive. Probably the vaccine strain had been circulating in the farm environment for a longer period before it reassorted with the very virulent field strain.

In conclusion, a new natural reassortant of very virulent IBDV was identified in Poland. The virus retained its high virulence despite the acquisition of a segment B from the attenuated IBDV strain. This finding shows that the mechanism of IBDV virulence is intricate and merits further investigations.

Abbreviations

B-BW: 

bursa to bodyweight index

BF: 

bursae of fabricius

BLAST: 

basic local alignment search tool

CAM: 

chorioallantoic membrane

EID50

mean embryo infective dose

HEPA: 

high efficiency particulate air filter

IBD: 

infectious bursal disease

NGS: 

next generation sequencing

SPF: 

specific-pathogen-free

rRT-PCR: 

real time RT-PCR

vvIBDV: 

very virulent infectious bursal disease virus

Declarations

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

AP conceived the study. AP and AL participated in the laboratory examinations and conducted animal experiments. AJ performed histopathological analysis. AP, AL, AJ and KŚ participated in interpretation of the results. AP and KŚ participated in statistical analyses and contributed to the writing of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

Authors are grateful to the employees of the Department of Omics Analysis, NVRI Puławy, for their help in high throughput sequencing results analysis.

Availability of data and materials

Genome sequences described in this manuscript are publicly available.

Ethics approval and consent to participate

This study and associated procedures were supervised and approved by the Local Ethical Commission in Lublin (Permit No. 87/2012) in agreement with the rules in place in the EU (Directive 2010/63/UE).

Funding

This work was partially funded by KNOW (Leading National Research Centre) Scientific Consortium “Healthy Animal - Safe Food”, decision of Ministry of Science and Higher Education No. 05-1/KNOW2/2015.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Poultry Diseases, National Veterinary Research Institute, Al. Partyzantow 57, 24-100 Pulawy, Poland
(2)
Department of Pathology, National Veterinary Research Institute, Al. Partyzantow 57, 24-100 Pulawy, Poland

References

  1. Eterradossi N, Saif YM (2013) Infections Bursal Disease. In: Swayne DE (ed) Diseases of Poultry, 13th edn. Wiley-Blackwell, AmesGoogle Scholar
  2. Wei Y, Yu X, Zheng J, Chu W, Xu H, Yu L (2008) Reassortant infectious bursal disease virus isolated in China. Virus Res 131:279–282View ArticlePubMedGoogle Scholar
  3. Li K, Courtillon C, Guionie O, Allée C, Amelot M, Qi X, Gao Y, Wang X, Eterradossi N (2015) Genetic, antigenic and pathogenic characterization of four infectious bursal disease virus isolates from China suggests continued evolution of very virulent viruses. Infect Genet Evol 30:120–127View ArticlePubMedGoogle Scholar
  4. Le Nouën C, Rivallan G, Toquin D, Darlu P, Morin Y, Beven V, Boisseson C, Cazaban C, Comte S, Gardin Y, Eterradossi N (2006) Very virulent infectious bursal disease virus: reduced pathogenicity in a rare natural segment-B reasserted isolate. J Gen Virol 87:209–216View ArticlePubMedGoogle Scholar
  5. Jackwood DJ, Sommer-Wagner SE, Crossley BM, Stoute ST, Woolcock PR, Charlton BR (2011) Identification and pathogenicity of a natural reassortant between a very virulent serotype 1 infectious bursal disease virus (IBDV) and a serotype 2 IBDV. Virology 420:98–105View ArticlePubMedGoogle Scholar
  6. Kasanga CJ, Yamaguchi T, Munan’andu HM, Ohya K, Fukushi H (2013) Genomic sequence of an infectious bursal disease virus isolate from Zambia: classical attenuated segment B reassortment in nature with existing very virulent segment A. Arch Virol 158:685–689View ArticlePubMedGoogle Scholar
  7. Abed M, Soubies S, Courtillon C, Briand FX, Allée C, Amelot M, De Boisseson C, Lucas P, Blanchrd Y, Belahouel Kara R, Essalhi A, Temim S, Khelef D, Eterradossi N (2018) Infectious bursal disease in Algeria: detection of highly pathogenic reassortants viruses. Inf Genet Evol 60:48–57View ArticleGoogle Scholar
  8. Soubies MS, Courtilion C, Briand FX, Queguiner-Leroux M, Coutois D, Amelot M, Grousson K, Morillon P, Herin JB, Eterradossi N (2017) Identification of a European interserotypic reassortant strain of IBDV. Avian Pathol 46:19–27View ArticlePubMedGoogle Scholar
  9. Coulibaly F, Chevalier C, Gutsche I, Pous J, Navaza J, Bressanelli S, Delmas B, Rey FA (2005) The birnavirus crystal structure reveals structural relationships among icosahedral viruses. Cell 120:761–772View ArticlePubMedGoogle Scholar
  10. Fahey KJ, Erny K, Crooks J (1989) A conformational immunogen on VP2 of infectious bursal disease virus that induces virus-neutralizing antibodies that passively protect chickens. J Gen Virol 70:1473–1481View ArticlePubMedGoogle Scholar
  11. von Einem UI, Gorbalenya AE, Schirrmeier H, Behrens SE, Letzel T, Mundt E (2004) VP1 of infectious bursal disease virus is an RNA-dependent RNA polymerase. J Gen Virol 85:2221–2229View ArticleGoogle Scholar
  12. Tacken MG, Thomas AA, Peeters BP, Rottier PJ, Boot HJ (2004) VP1, the RNA-dependent RNA polymerase and genome-linked protein of infectious bursal disease virus, interacts with the carboxy-terminal domain of translational eukaryotic initiation factor 4AII. Arch Virol 149:2245–2260View ArticlePubMedGoogle Scholar
  13. Luque D, Saugar I, Rejas MT, Carrascosa JL, Rodriguez JF, Castón JR (2009) Infectious bursal disease virus: ribonucleoprotein complexes of a double-stranded RNA virus. J Mol Biol 386:891–901View ArticlePubMedGoogle Scholar
  14. Hudson PJ, McKern NM, Power BE, Azad AA (1986) Genomic structure of the large RNA segment of infectious bursal disease virus. Nucleic Acids Res 14:5001–5012View ArticlePubMedPubMed CentralGoogle Scholar
  15. Lejal N, da Costa B, Huet JC, Delmas B (2000) Role of Ser-652 and Lys-692 in the protease activity of infectious bursal disease virus VP4 and identification of its substrate cleavage sites. J Gen Virol 81:983–992View ArticlePubMedGoogle Scholar
  16. Méndez F, Romero N, Cubas LL, Delgui L, Rodríguez D, Rodríguez JF (2017) Non-lytic egression of infectious bursal disease virus (IBDV) particles from infected cells. PLoS ONE 12:e0170080View ArticlePubMedPubMed CentralGoogle Scholar
  17. Li Z, Wang Y, Xue Y, Li X, Cao H, Zheng SJ (2012) Critical role for voltage-dependent anion channel 2 in infectious bursal disease virus-induced apoptosis in host cells via interaction with VP5. J Virol 86:1328–1338View ArticlePubMedPubMed CentralGoogle Scholar
  18. Minta Z, Daniel A (1994) Infectious bursal disease virus in Poland: Current situation and vaccinal control. In: Kaleta EF, Heffels-Redmann U, Lange-Herbst H (eds). In: Proceedings of the International Symposium on Infectious Bursal Disease and Chicken Infectious Anaemia. Rauischholzhausen, June 1994. World Veterinary Poultry Association, pp 208–214Google Scholar
  19. Domańska K, Mato T, Rivallan G, Śmietanka K, Minta Z, de Boisseson C, Toquin D, Lomniczi B, Palya V, Eterradossi N (2004) Antigenic and genetic diversity of early European isolates of Infectious bursal disease virus prior to the emergence of the very virulent viruses: early European epidemiology of Infectious bursal disease virus revisited? Arch Virol 149:465–480View ArticlePubMedGoogle Scholar
  20. World Organization for Animal Health (Office International des Epizooties) (2012) Infectious bursal disease. In: OIE manual of diagnostic tests and vaccines for terrestrial animals, 7th ed., ParisGoogle Scholar
  21. Wang Y, Qi X, Gao H, Gai Y, Lin H, Song X, Pei L, Wang X (2009) Comparative study of the replication of IBDV in DF-1 cell line and CEF evaluated by a new real-time RT-PCR. J Virol Methods 157:205–210View ArticlePubMedGoogle Scholar
  22. Pikuła A, Domańska-Blicharz K, Cepulis R, Śmietanka K (2017) Identification of infectious bursal disease virus with atypical VP2 amino acid profile in Latvia. J Vet Res 61:145–149View ArticlePubMedPubMed CentralGoogle Scholar
  23. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725–2729View ArticlePubMedPubMed CentralGoogle Scholar
  24. Nurk S, Bankevich A, Antipov D, Gurevich AA, Korobeynikov A, Lapidus A, Prjibelski AD, Pyshkin A, Sirotkin A, Sirotkin Y, Stepanauskas R, Clingenpeel SR, Woyke T, McLean JS, Lasken R, Tesler G, Alekseyev MA, Pevzner PA (2013) Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. J Comput Biol 20:714–737View ArticlePubMedPubMed CentralGoogle Scholar
  25. Social Science Statistics. https://www.socscistatistics.com/tests/Default.aspx. Accessed 6 Mar 2018
  26. Eterradossi N, Arnauld C, Toquin D, Rivallan G (1998) Critical amino acid changes in VP2 variable domain are associated with typical and atypical antigenicity in very virulent infectious bursal disease viruses. Arch Virol 143:1627–1636View ArticlePubMedGoogle Scholar
  27. McDonald SM, Nelson MI, Turner PE, Patton JT (2016) Reassortment in segmented RNA viruses: mechanism and outcomes. Nat Rev Microbiol 14:448–460View ArticlePubMedPubMed CentralGoogle Scholar
  28. Boot HJ, ter Huurne AAHM, Hoekman AJW, Peeters BPH, Gielkens ALJ (2000) Rescue of very virulent and mosaic infectious bursal disease virus from cloned cDNA: VP2 is not the sole determinant of the very virulent phenotype. J Virol 74:6701–6711View ArticlePubMedPubMed CentralGoogle Scholar
  29. Boot HJ, Hoekman AJW, Gielkens ALJ (2005) The enhanced virulence of very virulent infectious bursal disease virus is partly determined by its B-segment. Arch Virol 150:137–144View ArticlePubMedGoogle Scholar
  30. Le Nouën C, Toquin D, Muller H, Raue R, Kean KM, Langlois P, Cherbonnel M, Eterradossi N (2012) Different domains of RNA polymerase of infectious bursal disease virus contribute to virulence. PLoS One 7:e28064View ArticlePubMedPubMed CentralGoogle Scholar
  31. Escaffre O, Le Nouën C, Amelot M, Ambroggio X, Ogden KM, Guionie O, Toquin D, Muller H, Islam MR, Eterradossi N (2013) Both genome segments contribute to the pathogenicity of very virulent infectious bursal disease virus. J Virol 87:2767–2780View ArticlePubMedPubMed CentralGoogle Scholar
  32. Lu Z, Zhang L, Wang N, Chen Y, Gao L, Wang Y, Gao H, Li K, Qi X, Wang X (2015) Naturally occurring reassortant infectious bursal disease virus in northern China. Virus Res 203:92–95View ArticlePubMedGoogle Scholar
  33. Yao K, Goodwin MA, Vakharia VN (1998) Generation of a mutant infectious bursal disease virus that does not cause bursal lesions. J Virol 71:5647–5651Google Scholar

Copyright

© The Author(s) 2018

Advertisement