Skip to main content

Table 1 Primers used for amplification and cloning of the cytokines and the Caev-Cork env gene used in entry assays.

From: Small ruminant macrophage polarization may play a pivotal role on lentiviral infection

Molecule Primer Probe Amplicon length
  Forward Reverse   
IL-4 AATTCTCGAG ACCATGG GTCTCACCTCCCAGC AATTTGGTACC TCAACACTTTGAGTATTTCTCC   472 nt
IL-13 AATTCTCGAG ACCATGG CGCTCTTCTTGAC ATTTGGTACC TCAGTTGTAACTTCCATTGCG   556 nt
IL-10 AATTCTCGAG ACCATG CCCAGCAGCTCAG ATTTGGTACC TTACATCTTCGTTGTCATGTA   419 nt
CAEV-Cork env ATATAGATCT CCACCATG ATTTGCGGCCGC TATTAGTCCTCTTTAG   2834 nt
TNF-α qPCR GGTGCCTCAGCCTCTTCTC GAACCAGAGGCCTGTTGAAG 6-FAM-TGGTTGCAGGAGCCACCACG-TAMRA 134 nt
CD80 qPCR CTGTGATTACAACACGACCACTGA ATGGTGCGGTTCTCGTATTCA 6-FAM-AACTGGCAAGCCTTCGGATCTACTGGC-TAMRA 128 nt [30]
A3Z1 qPCR TCCGTTCTTGGAATCTGGAC GTATAGATGCGGGAGGCAAA   151 nt
MR qPCR TGGCAAATCCAGTTGTTAAGATGTT AGAATGTTGAATACTGTGGCGAGTT   91 nt [31]
DC-SIGN qPCR GGTTCCGGAGTCTGACTGAAGTT GGTCAGGCGCTGTAGGATCTC   73 nt
IL-10 qPCR CGGCGCTGTCATCGTTTT TCTTGGAGCATATTGAAGACTCTCTTC 6-FAM-CCTGCTCCACCGCCTTGCTCTTG-TAMRA 82 nt
  1. Sequences are listed 5′to 3′; restriction enzyme recognition sites are underlined; Kozak sequences are in bold. A3Z1, MR and DC-SIGN were amplified using SybrGreen Master Mix (Takara).
  2. Primers and probes (when corresponding) for relative expression quantification using real time PCR (qPCR) are also indicated.