Skip to main content

Table 1 Primers used in the RT-qPCR assays of sorted porcine NK cells

From: Porcine CD8αdim/-NKp46high NK cells are in a highly activated state

Target gene – accession number Target Primer sequences Position on + strand Product length (bp) Product melt.temp (°C)
   forward (F) and reverse (R)    
NM_001123143 NKp46 primers as published in [20], rtprimerdb ID: 8346   110 87.0
XM_003135179.3 CXCR3 F: CCGACCACAAGCACCAAAGCA −69 94 90.0
  1. Sequences of primers (5´-3´) for target genes as well as primer positions on (+) strand, length of specific product in base pairs (bp) and product melting temperature in °C are indicated.