A protein-based subunit vaccine with biological adjuvants provides effective protection against Pasteurella multocida in pigs

Table 2 Sequences of primers for swine cytokines and GAPDH for real-time PCR

Gene	Primer	Sequence (5′ → 3′)	Length (bp)	Accession No.^a	Denaturation	Amplification conditions^b Annealing temperature
GADPH	F	TGAATTTGGCTACAGCAACAGG	186	XM_039874164.1	95 °C (5 min)	53.2 ℃ (20 s),
GADPH	R	GGTCTGGGATGGAAACTGGA	186	XM_039874164.1		53.2 ℃ (20 s),
IFN-γ	F	ACTTGGTGTTATGGTGACTG	197	X53085		57 ℃ (20 s)
IFN-γ	R	TAGGATGTCTAGTAGTGAG	197	X53085		57 ℃ (20 s)
IL-4	F	TGACGGACGTCTTTGCTGC	178	X68330		50.8 ℃ (20 s)
IL-4	R	TCTGTGCATGAAGCCAAGAA	178	X68330		50.8 ℃ (20 s)

F: forwards, R: reverse.
^aGenBank accession number of cDNA and corresponding gene, available at National Center for Biotechnology Information.
^bDenaturation at 95 ℃ for 45 s and extension at 72 ℃ for 30 s, for a total of 44 cycles.

ISSN: 1297-9716