Skip to main content

Table 1 Strains, plasmids and primers.

From: Salmonella enterica serovar Choleraesuis vector delivering a dual-antigen expression cassette provides mouse cross-protection against Streptococcus suis serotypes 2, 7, 9, and 1/2

Strain or plasmid or primer Characteristicsa or sequencesb Source, reference or function
Bacterial strains
 BL21 For expression the recombinant plasmids Invitrogen
 χ7213 thi-1 thr-1 leuB6 fhuA21 lacY1 glnV44 asdA4 recA1 RP4 2-Tc::Mu pir; Kmr [48]
 rSC0016 ΔPcrp527::TT araCPBADcrp Δpmi-2426 ΔrelA199::araCPBADlacITT ΔsopB1686 ΔasdA33 [29]
 Streptococcus suis serotype 2 Wild type, virulent, CVCC3928 Lab stock
 Streptococcus suis serotype 7 Wild type, virulent, SH04805 Provided by Professor Huochun Yao
 Streptococcus suis serotype 9 Wild type, virulent, GZ0565 Provided by Professor Huochun Yao
 Streptococcus suis serotype 1/2 Wild type, virulent, 2651 Provided by Professor Huochun Yao
Plasmids
 pYA3493 Asd+; pBR ori, Ptrc promoter, β-lactamase signal sequence-based periplasmic secretion plasmid [49]
 pS-SaoA pYA3493 with SaoA, Ptrc promoter [29]
 pS-Eno pYA3493 with Eno, Ptrc promoter This study
 pS-SE pYA3493 with a dual antigen expression cassettes consisting of SS2-SaoA and SS9-Eno, Ptrc promoter This study
 pET28a-SaoA SS2-SaoA expression vector, T7 promoter; Kmr [29]
 pET28a-Eno SS9-Eno expression vector, T7 promoter; Kmr This study
Primers
 SS9-Eno-F CGCTGCAGAGGACGCAAAAAATGAAAAAGACGGCTATCGC The ORF of SS9-Eno
 SS9-Eno-R GCAAGCTTTTACTTTTTCAAGTTATAGAAT  
 SE-F ATCCCGGGCAACCTGATGGGGGCCAGG The ORF of SaoA-Eno
 SE-R GCAAGCTTTTACTTTTTCAAGTTATAGAAT  
  1. aKmr Kanamycin resistance. bUnderlined nucleotides denote enzyme restriction sites.