Skip to main content

Table 1 Strains, plasmids and primers.

From: Salmonella enterica serovar Choleraesuis vector delivering a dual-antigen expression cassette provides mouse cross-protection against Streptococcus suis serotypes 2, 7, 9, and 1/2

Strain or plasmid or primer

Characteristicsa or sequencesb

Source, reference or function

Bacterial strains

 BL21

For expression the recombinant plasmids

Invitrogen

 χ7213

thi-1 thr-1 leuB6 fhuA21 lacY1 glnV44 asdA4 recA1 RP4 2-Tc::Mu pir; Kmr

[48]

 rSC0016

ΔPcrp527::TT araCPBADcrp Δpmi-2426 ΔrelA199::araCPBADlacITT ΔsopB1686 ΔasdA33

[29]

 Streptococcus suis serotype 2

Wild type, virulent, CVCC3928

Lab stock

 Streptococcus suis serotype 7

Wild type, virulent, SH04805

Provided by Professor Huochun Yao

 Streptococcus suis serotype 9

Wild type, virulent, GZ0565

Provided by Professor Huochun Yao

 Streptococcus suis serotype 1/2

Wild type, virulent, 2651

Provided by Professor Huochun Yao

Plasmids

 pYA3493

Asd+; pBR ori, Ptrc promoter, β-lactamase signal sequence-based periplasmic secretion plasmid

[49]

 pS-SaoA

pYA3493 with SaoA, Ptrc promoter

[29]

 pS-Eno

pYA3493 with Eno, Ptrc promoter

This study

 pS-SE

pYA3493 with a dual antigen expression cassettes consisting of SS2-SaoA and SS9-Eno, Ptrc promoter

This study

 pET28a-SaoA

SS2-SaoA expression vector, T7 promoter; Kmr

[29]

 pET28a-Eno

SS9-Eno expression vector, T7 promoter; Kmr

This study

Primers

 SS9-Eno-F

CGCTGCAGAGGACGCAAAAAATGAAAAAGACGGCTATCGC

The ORF of SS9-Eno

 SS9-Eno-R

GCAAGCTTTTACTTTTTCAAGTTATAGAAT

 

 SE-F

ATCCCGGGCAACCTGATGGGGGCCAGG

The ORF of SaoA-Eno

 SE-R

GCAAGCTTTTACTTTTTCAAGTTATAGAAT

 
  1. aKmr Kanamycin resistance. bUnderlined nucleotides denote enzyme restriction sites.