Skip to main content

Table 2 Primer sequences used in the expression of the His-MsrA fusion protein

From: Luteolin increases susceptibility to macrolides by inhibiting MsrA efflux pump in Trueperella pyogenes

Gene Orientation Sequence (5′-3′) Restriction site
msrA Forward GGATCCATGGAACAATATACAATTAAATTTAACCAAATCA BamH I
Reverse AAGCTTTTAAGTTATATCATGAATAGATTGTCCTGTTAATTCC Hind III