Skip to main content

Table 1 List of primers used in the study

From: GADD34-mediated dephosphorylation of eIF2α facilitates pseudorabies virus replication by maintaining de novo protein synthesis

Primer name Primer sequence (5’-3’)
PRV-gE F CCACTCGCAGCTCTTCTCG
PRV-gE R CAGTCCAGCGTGGCAGTAAA
β-actin F CGGCATCCACGAAACTACCT
β-actin R GCCGTGATCTCCTTCTGCAT
eIF2α F GTCGACCGAGATCTCTCGAG
ATGCCGGGTCTGAGTTGTAGAT
eIF2α R CGCGGCCGCGGTACCTCGAGTT
AATCTTCAGCTTTGGCTTCC
eIF2α(S51A) F CTTCTTAGTGAGCTCGCCAG
AAGGCGTATCC
eIF2α(S51A) R GGATACGCCTTCTGGCGAG
CTCACTAAGAAG
eIF2α(S51D) F CTTCTTAGTGAGCTCGACAG
AAGGCGTATCCG
eIF2α(S51D) R CGGATACGCCTTCTGTCGAG
CTCACTAAGAAG
shNC TTCTCCGAACGTGTCACGT
shGADD34-1# GGCTGGAGAAGCTGTAAATAA
shGADD34-2# GAGCCCGGAAGTGAATTTATG
shGADD34-3# GTGGCTGAGTTGAAGTAGTTT
shGADD34-4# GGCCATCTATTTACCTGGAGA