Skip to main content

Table 1 List of primers for real-time PCR.

From: Prototheca spp. induce an inflammatory response via mtROS-mediated activation of NF-κB and NLRP3 inflammasome pathways in bovine mammary epithelial cell cultures

Gene Primer Sequence (5’-3’) Size (bp)
GAPDH Forward
Reverse
TCACCAACTGGGACGACA
GCATACAGGGACAGCACA
206
TNF-α Forward
Reverse
ATGTGTGTGGAGAGCGTCAA
GGGCCATACAGCTCCACAAA
145
IL-1β Forward
Reverse
ATGACTTCCAAGCTGGCTGTTG
TTGATAAATTTGGGGTGGAAAG
114
IL-18 Forward
Reverse
TTGCATCAGCTTTGTGGAAA
TGGGGTGCATTATCTGAACA
213