Skip to main content

Table 1 Details of primers used in the qRT-PCR analysis of gene signatures, interferons and cytokines

From: Route of infectious bronchitis virus vaccination determines the type and magnitude of immune responses in table egg laying hens

Gene group Gene target Primer sequences: forward (F) and reverse (R) Reference
Reference gene 18S ribosomal RNA (F) TGTGCCGCTAGAGGTGAAATT [14]; [41]
(R) TGGCAAATGCTTTCGCTTT
Cellular immune response CD8-α (F) TTG GAC GGG ACC TTA CAG AC [14]
(R) TGA AGG GAG CAA AGG AGA AA
CD8-β (F) CTGCATGGCTCCGACAATGG [40]
(R) ATCGACCACGTCAAGCTGGG
Mucosal immune response ChIgA (chicken immunoglobulin A) (F) TGCAGGGCAATGAGTTCGTCTGTA [42]
(R) AGGAGGTCACTTTGGAGGTGAAT
ChIgY (chicken immunoglobulin G) (F) GACGAAGCTT TTCCTCTTCT [43]
(R) CCCGATTGTA CCCTCTATCG
Viral recognition TLR3 (toll-like receptor 3) (F) GCAATTTCTCCTTCACCTTTTCA [44]
(R) CCTTTATGTTTGCTATGTTGTTATTGCT
MDA5 (melanoma differentiation-associated protein 5) (F) AGGAGGACGACCACGATCTCT [44]
(R) CCACCTGTCTGGTCTGCATGT
Interferon IFN-β [interferon beta (type I)] (F) TCCAACACCTCTTCAACATGCT [44]
(R) TGGCGTGTGCGGTCAAT
Inflammation IL-6 (interleukin 6) (F) CACGATCCGGCAGATGGT [44]
(R) TGGGCGGCCGAGTCT