Skip to main content

Table 1 Primer sequences used in this study

From: Identification and functional characterization of a fish-specific tlr19 in common carp (Cyprinus carpio L.) that recruits TRIF as an adaptor and induces ifn expression during the immune response

Primer name Primer sequence (5′–3′) Usage
TLR19-F TGCATCGATGCTGAGTCGCTG tlr19 cloning
TLR19-R GGCAGAGCTTCTCCATTGTGGCCA tlr19 cloning
TLR19-5′outer AGCGAGCAAAGCGATAACCAGCGG 5′RACE
TLR19-5′inner GCGATAACCAGCGGCTGCCAACAG 5′RACE
TLR19-3′outer GGAACAAGGGAACCCGAGACTGA 3′RACE
TLR19-3′inner GAGAGTATCCACAGCAGTCAGTGC 3′RACE
TLR19-NI-F ACATCCTGCAGGAATGGGTGTGCATGACTCC Plasmid construction
TLR19-SI-R CTAGCTAGCTCAAGAAGCTTCCGCGTC Plasmid construction
TLR19-EI-F CGGAATTCATGGGTGTGCATGACTCC Plasmid construction
TLR19-SI-R GGATTCCCTCAAGAAGCTTCCGCGTC Plasmid construction
rtTLR19-F GCCGCTGGTTATCGCTTTGCT Real-time PCR
rtTLR19-R ATCCTCCTGTGCCACTGCCTAC Real-time PCR
rtS11-F CCGTGGGTGACATCGTTACA Real-time PCR
rtS11-R TCAGGACATTGAACCTCACTGTCT Real-time PCR
Rab5-F CCCAAGCTTATGGCAGGAAGAGGCGGA Plasmid construction
Rab5-R CGGGGTACCGTGTTGCTACAGCGGGACC Plasmid construction
Rab7-F CCCAAGCTTATGACATCAAGGAAGAAAGTTC Plasmid construction
Rab7-R CGGGGTACCGTGCAGCTACAAGTCTCTGC Plasmid construction
TRIF-F CCCAAGCTTCGCCACCATGGCAGATGGTGGAGTAGAG Plasmid construction
TRIF-R CGCGGATCCCGAGAATCAAACCCATTGGGCGAG Plasmid construction
MyD88-F CCCAAGCTTCGCCACCATGGCATCAAAATCAAGTATAGAC Plasmid construction
MyD88-R CGCGGATCCCGTTGAAAAGATCGGGGCAGTGC Plasmid construction
TIRAP-F CCCAAGCTTCGCCACCATGGAGGAAGACGCGTCAG Plasmid construction
TIRAP-R CGCGGATCCCGGCCGTCAGATTGAGATGCAC Plasmid construction
EPC-ifn-1-F ATGAAAACTCAAATGTGGACGTA Real-time PCR
EPC-ifn-1-R GATAGTTTCCACCCATTTCCTTAA Real-time PCR
EPC-Viperin-F AGCGAGGCTTACGACTTCTG Real-time PCR
EPC-Viperin-R GCACCAACTCTCCCAGAAAA Real-time PCR
EPC-β-actin-F GCCGTGACCTGACTGACTACCT Real-time PCR
EPC-β-actin-R GCCACATAGCAGAGCTTCTCCTTG Real-time PCR