Skip to main content

Table 1 Sequences of primers used in this study

From: Experimental co-infection of variant infectious bursal disease virus and fowl adenovirus serotype 4 increases mortality and reduces immune response in chickens

Primer name Nucleotide sequences References
β-actin CAACACAGTGCTGTCTGGTGGTA [21]
ATCGTACTCCTGCTTGCTGATCC
IL-6 CCAGAAATCCCTCCTCGCCAATC [23]
GCCCTCACGGTCTTCTCCATAAAC
IL-1β TCATCTTCTACCGCCTGGAC [22]
GTAGGTGGCGATGTTGACCT
IFN-α ATGCCACCTTCTCTCACGAC [22]
AGGCGCTGTAATCGTTGTCT
IFN-γ ACACTGACAAGTCAAAGCCGC [21]
AGTCGTTCATCGGGAGCTTG