Skip to main content

Table 2 PCR primers for constructing donor plasmid and detecting the recombinant virus

From: A novel fiber-2-edited live attenuated vaccine candidate against the highly pathogenic serotype 4 fowl adenovirus

PCR products Sequences of primers (5′–3′)
HAL F: GGTGACCTACTGACCCTCAACACC
R: CAGCTCCTCGCCCTTGCTCACCATTGTTCCCGTTGGGGGA
EGFP F: TCCCCCAACGGGAACAATGGTGAGCAAGGGCGAGGAGCTG
R: CTTCTTTTAGGGGCCCGGAGCTTGTACAGCTCGTCCATG
fiber-2 + HAR F: CATGGACGAGCTGTACAAGCTCCGGGCCCCTAAAAGAAG
R: CTACTTTACCTGCATTTCGTCAG
Partial fiber-2 F: CTCCAACTGGTTTGACCAGAACG
R: GTCAAGCTGGGATGCTCTCACCATGC