Skip to main content

Table 1 Primer sequences for qRT-PCR

From: Analysis of chicken macrophage functions and gene expressions following infectious bronchitis virus M41 infection

Gene Primer Sequences (5′–3′) Product length (bp) Accession number
IBV N F: CAAGCTAGGTTTAAGCCAGGT 218 FJ904723.1
R: TCTGAAAACCGTAGCGGATAT
TLR3 F: ACCCGGATTGCAGTCTCAGTA 95 NM_001011691.3
R: CACTGTCCTTGCAGGCTGAG
TLR7 F: ACCGTCGCCTCAAGGAAGTCC 145 NM_001011688.2
R: ACGCAGTTGCACCTGAAGTCAATC
MyD88 F: AAGGTGTCGGAGGATGGTGGTC 120 NM_001030962.4
R: GGAATCAGCCGCTTGAGACGAG
MDA5 F: TCAGGAGGAGGACGACCACGAT 168 GU570144.1
R: TTCCCACGACTCTCAATAACAG
IFN-α F: GGACATGGCTCCCACACTAC 75 GU119896.1
R: TCCAGGATGGTGTCGTTGAAG
IFN-β F: GCCCACACACTCCAAAACACTG 151 GU119897.1
R: TTGATGCTGAGGTGAGCGTTG
IFN-γ F: CACTGACAAGTCAAAGCCGC 87 NM_205149.1
R: ACCTTCTTCACGCCATCAGG
MHCI F: GCCAACACGGACCAGCAGTAC 81 NM_001097530.1
R: GTCCAGGTTCTCGCGGTCAATC
MHCII F: GTTCTACCAGCGTTCGGAAGGC 101 DQ207939.1
R: TCTGAGCGGCGTCCAACTCC
Fc receptor F: TGTGAGGTGCGGACGGAGAG 195 AM412311.1
R: TCGGTGCCAGGAGAAGGAGATG
MARCO F: CACATAAGCGAGCCTCGAATCCAG 81 NM_204736.1
R: CAGCAGCAGCAGGTAGATGACAAG
CD36 F: ACCAGACCAGTAAGACCGTGAAGG 154 NM_001030731.1
R: ATGTCTAGGACTCCAGCCAGTGTG
MIF F: ATTGGCAAGATTGGAGGG 127 M95776.1
R: CGTTGGCAGCATTTATGTC
CCL4 F: GCAGTTGTTCTCGCTCTTC 192 NM_204720.1
R: GCGCTCCTTCTTTGTGAT
K60 F: GCTGCTGTCATGGCTCTT 278 Y14971.1
R: TTGGTGTCTGCCTTGTCC
XCL1 F: ATGAAACTCCACGCCACAGTT 294 NM_205046.1
R: TTATCTTCTTCTGGTAGTACG
CXCL12 F: TGTCGGAGGAGAAGCCTGTCAG 158 NM_204510.1
R: CACTTGCTTGCTGTTGCTCTTGAG
IL-1β F: TGGGCATCAAGGGCTACA 244 Y15006.1
R: TCGGGTTGGTTGGTGATG
IL-6 F: ATGGTGATAAATCCCGATGAAG 153 NM_204628.1
R: CCTCACGGTCTTCTCCATAAAC
TNF-α F: CAGATGGGAAGGGAATGAAC 268 NM_204267.1
R: AGAGCATCAACGCAAAAGGG
NF-κB F: TCAACGCAGGACCTAAAGACAT 162 M86930.1
R: GCAGATAGCCAAGTTCAGGATG
iNOS F: AGTGGTATGCTCTGCCTGCT 171 NM_204961.1
R: CCAGTCCCATTCTTCTTCC
IL-10 F: CAGCACCAGTCATCAGCAGAGC 94 NM_001004414.2
R: GCAGGTGAAGAAGCGGTGACAG
PPAR-γ F: GGGCGATCTTGACAGGAA 175 AB045597.1
R: GCCTCCACAGAGCGAAAC
LC3II F: GTACGAGAGCGAGAAGGACG 83 NM_001031461.1
R: AGACGGAAGATTGCACTCCG
mTOR F: CATGTCAGGCACTGTGTCTATTCTC 77 XM_417614.5
R: CTTTCGCCCTTGTTTCTTCACT
Beclin-1 F: TGGCTTTCTTGGACTGTGTG 125 NM_001006332.1
R: ACCACCACTGCCACCTGTAT
Caspase-3 F: CCACCGAGATACCGGACTGT 176 NM_204725.1
R: AACTGCTTCGCTTGCTGTGA
Bax F: ACTCTGCTGCTGCTCTCCTCTC 174 XM_025145468.1
R: ATCCACGCAGTGCCAGATGTAATC
Bcl-2 F: GAGTTCGGCGGCGTGATGTG 92 NM_205339.2
R: TTCAGGTACTCGGTCATCCAGGTG
β-actin F: ATTGCTGCGCTCGTTGTT 173 K02173.1
R: CTTTTGCTCTGGGCTTCA
  1. F: Forward primer for qRT-PCR, R: Reverse primer for qRT-PCR