Skip to main content

Table 2 Oligonucleotide primers used for amplification of the second exon of the Ovar-DRB1 locus.

From: A novel technique for retrospective genetic analysis of the response to vaccination or infection using cell-free DNA from archived sheep serum and plasma

Primer namePosition relative to the first base of the second exon of the Ovar-DRB1 locusForward (F) or reverse (R)Sequence
275Intron 1 (−55 to −35)FATTAGCCTCTCCCCAGGAGTC
329Exon 2/intron 2 (263 to +15)RCACCCCCGCGCTCAC/CTCGCCGC
330Intron 1 (−55 to −35)FATTAGCCTCYCCCCAGGAGKC
455Intron 1/exon 2 (−16 to +8)FTATCCCGTCTCTGCAG/CACATTTC
KBEH1Intron 1/exon 2 (−7 to +14)FTCTGCAG/CACATTTCYTGGAG
  1. Intron 1 sequence is indicated as negative, intron 2 sequence is indicated as positive. Positions 1 to 270 indicate exon 2. The intron exon boundary is marked by /.