Skip to main content

Table 1 Sequences and primer pair characteristics

From: Duck enteritis virus pUL47, as a late structural protein localized in the nucleus, mainly depends on residues 40 to 50 and 768 to 777 and inhibits IFN-β signalling by interacting with STAT1

Primer Plasmid Primer sequence (5′ → 3′)
P1 pET-32a-UL47 G/GATCCAGACAGCGCCGTAGGTCA
P2 C/TCGAGAACTATTGCCGGATTAACAGG
P3 DEV UL47 (RT-PCR) AACGGAGTTGCTTGGAGAACA
P4 TGGGCGATGAAACAGAGTAGG
P5 Duck β-actin (RT-PCR) CCGGGCATCGCTGACA
P6 GGATTCATCATACTCCTGCTTGCT
P7 DEV UL54 (RT-PCR) GAACAACCGCCGAACAC
P8 TCAAACATCCGCCTCAA
P9 DEV UL13 (RT-PCR) GCCACCAACCCTACCAAG
P10 GTCGTCAGCCCATCACCA
P11 DEV Us2 (RT-PCR) AGACGGTTCCGAAAGTACAG
P12 TCGGCAGCACCAATAATCC
P13 pcaggs-UL47-Flag CATCATTTTGGCAAAG/AATTCGCCACCATGGCCATGGATAAATCACGAAGAC
P14 TTGGCAGAGGGAAAAA/GATCTTTACTTGTCATCGTCGTCCTTGTAATCATGTAACTCTCTCCGCCC
P15 pcasggs-STAT1-myc CATCATTTTGGCAAAG/AATTCGCCACCATGGCCGAGCAGAAACTCATCTCTGAAGAGGATCTGATGACTCAGTGGTACCAG
P16 GGCAGAGGGAAAAA/GATCTTTAAGTTGAATATGCTGAACAC
P17 pEGFP-C2-40-50 AATTCAGGAGAAGTGGTAAGAGACGTACACTTGACAGGG
P18 GATCCCCTGTCAAGTGTACGTCTCTTACCACTTCTCCTG
P19 pEGFP-C2-768-777 AATTCAAAGCATTAAAACGACGTTTGACTGGTGGGG
P20 GATCCCCCACCAGTCAAACGTCGTTTTAATGCTTTG
P21 pEGFP-C2-40-50-β-gal CTCGAGCTCAAGCTTCG/AATTCAGGAGAAGTGGTAAGAGACGTACACTTGACAGGATGAGCGAAAAATACATCG
P22 CAGTTATCTAGATCCGGTG/GATCCTTATTTTTGACACCAGAC
P23 pEGFP-C2-768-777-β-gal CTCGAGCTCAAGCTTCG/AATTCAAAGCATTAAAACGACGTTTGACTGGTGGGATGAGCGAAAAATACATCG
P24 CAGTTATCTAGATCCGGTG/GATCCTTATTTTTGACACCAGAC
P25 pcDNA3.1 (+)-Flag-UL47Δ40-50-768-777 GCTTGGTACCGAGCTCG/GATCCGCCACCATGGATTACAAGGATGACGACGATAAGATGGATAAATCACGAA
P26 GTTTAAACGGGCCCTCTAGAC/TCGAGTTAATGTAACTCTCTCCGC
P27 pcDNA3.1-C-UL47-LgBiT CTGTTGGTAAAGCCACCA/GATCTGCCACCATGGATAAATCACGAAG
P28 CCGCTCCCGCCACCACCGC/TCGAGGGCTTGTCATCGTCGTCCTTGTAATCATGTAACTCTCTCCGCCC
P29 pcDNA3.1-N-STAT1-SmBiT GAGCGGAGGTGGAGGC/TCGAGCATGACTCAGTGGTACCAG
P30 CCGCCCCGACTCTAGAA/GATCTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCAGTTGAATATGCTGAACAC