Skip to main content

Table 1 PCR primers used in this study

From: Matrine inhibits IL-1β secretion in primary porcine alveolar macrophages through the MyD88/NF-κB pathway and NLRP3 inflammasome

GenePrimer sequence
5′UTRF: CGGGATCCATGACGTATAGGTGTTGGCT
R: CCGCTCGAGGGTTAAAGGGGTGGAGAGA
IL-1βF: CCCAAAAGTTACCCGAAGAGG
R: TCTGCTTGAGAGGTGCTGATG
IL-6F: ACAAAGCCACCACCCCTAAC
R: CGTGGACGGCATCAATCTCA
IL-8F: TTCACAAGTCTCTGCTCAACTG
R: TGTCCTCAAGGTAGGATGGG
TNF-αF: CCCTCACGTCCTTCTGGTTT
R: GAGTCTGGAAGCCCCAGTTC
GAPDHF: TTGGCTACAGCAACAGGGTG
R: CAGGAGATGCTCGGTGTGTT