Skip to main content

Advertisement

Table 1 List of the primers used in the qPCR assay

From: Toll-like receptor 5-mediated IL-17C expression in intestinal epithelial cells enhances epithelial host defense against F4+ ETEC infection

Gene Sequence (5′ → 3′) Size (bp) Ta (°C) References
IL-17A F: ACTCCAAACGCTTCACCTCAC 234 58 [17]
R: AGCCCACTGTCACCATCACTT
IL-17C F: CGTGTGGACACGGATGAGAG 217 60 Present study
R: GGATGAACTCGGCGTGGAAG
IL-17RE F: CCCAGATTCCTCGCCATACC 106 60 Present study
R: CCTGGCAACAGATACAGGCA
TLR1 F: AGATTTCGTGCCACCCTATG 277 55 [50]
R: CCTGGGGGATAAACAATGTG
TLR2 F: TGCTATGACGCTTTCGTGTC 163 55
R: CGATGGAGTCGATGATGTTG
TLR3 F: GAGCAGGAGTTTGCCTTGTC 149 55
R: GGAGGTCATCGGGTATTTGA
TLR4 F: TCATCCAGGAAGGTTTCCAC 234 55
R: TGTCCTCCCACTCCAGGTAG
TLR5 F: GGTCCCTGCCTCAGTATCAA 114 55
R: TGTTGAGAAACCAGCTGACG
TLR6 F: TCAAGCATTTGGACCTCTCA 170 58
R: TTCCAAATCCAGAAGGATGC
TLR7 F: TCTGCCCTGTGATGTCAGTC 317 55
R: GCTGGTTTCCATCCAGGTAA
TLR8 F: CTGGGATGCTTGGTTCATCT 241 55
R: CATGAGGTTGTCGATGATGG
TLR9 F: AGGGAGACCTCTATCTCCGC 205 55
R: AAGTCCAGGGTTTCCAGCTT
TLR10 F: GCCCAAGGATAGGCGTAAAT 128 55
R: CTCGAGACCCTTCATTCAGC
pBD-2 F: CTGTCTGCCTCCTCTCTTCC 168 60 [51]
R: CAGGTCCCTTCAATCCTGTT
Claudin-1 F: ACCCGCACTACGTCACCTTC 146 60 Present study
R: GGCAGGACACCTGGTCATTG
Claudin-2 F: AGAAGTTTCAAAGCCTGGGAG 119 60 [52]
R: TCAACCTCATACAGGGGCAAA
Occludin F: GTGGTAACTTGGAGGCGTCTTC 102 58 [53]
R: CCGTCGTGTAGTCTGTCTCGTA
ZO-1 F: AAGGATGTTTACCGTCGCATT 253 60
R: ATTGGACACTGGCTAACTGCT
TNF-α F:GCATGGTGGTGGTTGTTTCTGACGAT 99 60
R:GCTTCTGTTGGACACCTGGAGACA
IL-8 F: TCTCGGTGTAGAGCAAGG 146 58
R: TTCCCAAAGTGCTGGTATT
β-Actin F: TCATCACCATCGGCAACG 133 60 [54]
R: TTCCTGATGTCCACGTCGC
GAPDH F: GGGCATGAACCATGAGAAGT 230 60 [55]
R: AAGCAGGGATGATGTTCTGG
RPL19 F: AACTCCCGTCAGCAGATCC 147 60 [56]
R: AGTACCCTTCCGCTTACCG