Skip to main content

Table 2 Primers used in this study

From: The CpxR regulates type VI secretion system 2 expression and facilitates the interbacterial competition activity and virulence of avian pathogenic Escherichia coli

Primers Sequence (5′ to 3′)a Target genes
For gene expression, deletion and complementation
 cpxREx-F ACGGGATCCATGAATAAAATCCTGTTAGTTGATGA cpxR
 cpxREx-R ACCAAGCTTTGAAGCAGAAACCATCAGATAG cpxR
 cpxRMu-F GGATTAGCGACGTCTGATGACGTAATTTCTGCCTCGGAGGTATTTAAACAGTGTAGGCTGGAGCTGCTTC Upstream region of cpxR
 cpxRMu-R AAGATGCGCGCGGTTAAGCTGCCTATCATGAAGCAGAAACCATCAGATAGCATATGAATATCCTCCTTAG Downstream region of cpxR
 cpxR-F TTGATCTTCTGGACGACAGCA cpxR
 cpxR-R CTCAGTACCGGTTAACTCCAGT cpxR
 cpxRCo-F TCCGGATCCATATCAATAATTTCTTGCCGTTC Upstream region of cpxR
 cpxRCo-R CCCAAGCTTGGCCTGACCAATAAAGTTACG Downstream region of cpxR
 nlpE-F GAGCTCGAGGGTGAAAAAAGCGATAGTGA nlpE
 nlpE-R TTCGAATTCTGCCCCAAACTACTGCAATC nlpE
For RT-qPCR
 dnaE RT-F ATGTCGGAGGCGTAAGGCT dnaE
 dnaE RT-R TCCAGGGCGTCAGTAAACAA dnaE
 hcp2B RT-F GTGAAATGCTGCCGAAAGTG hcp2B
 hcp2B RT-R ACAATCGTCGCGTCAGTAAG hcp2B
 vgrG RT-F CGAAGACGCAGATGACGATAC vgrG
 vgrG RT-R GCGTGGATATAGACCTGTTCAC vgrG
 xmtU RT-F GGTGTCATATCCGGTACATCTC xmtU
 xmtU RT-R CTGAACCATGATAAGCAACAGG xmtU
 vipA RT-F TAACACGCCGTTGGATGAG vipA
 vipA RT-R GTTCAGCCGGAACAACAAAC vipA
 clpV RT-F GAGACGCTCGCTACCATTATT clpV
 clpV RT-R TGATTTCGTCCGTCACTTCC clpV
 hcp2A RT-F ACGAAACCGGTGGACAAA hcp2A
 hcp2A RT-R GGTTGGTGCGGTAGAATACA hcp2A
For lacZ fusion and EMSA
 Phcp2B-F TCTAAGCTTAGCTTATGTAATCGTGTTCTGAA Upstream region of hcp2B
 Phcp2B-R GACGGATCCTTGAAATGTAACATGGGGTTGG hcp2B
 Phcp2BEMSA-F AGCTTATGTAATCGTGTTCTG Upstream region of hcp2B
 Phcp2B EMSA-R CATGGGGTTGGCATTTATGAA hcp2B
 Phcp2BdeletionEMSA-F TTGACTAAAAATATATTTAAAC Upstream region of hcp2B
  1. aRestriction sites are underlined.