Skip to main content

Table 1 Primers used to construct the recombinant plasmids

From: UBXN1 interacts with the S1 protein of transmissible gastroenteritis coronavirus and plays a role in viral replication

Gene Accession number Purpose Sequence (5′–3′)
TGEV-S1 DQ811786.2 Construction of pGBKT7-S1 F: CTCTTCCAGCCCTCCTTCC
R: GGTCCTTGCGGATGTCG
TGEV-S1-t XM_003353824.1 Construction of pGEX-4T-S1 F: CGGAATTCGAGAAGGCTCTGGCCCTCA
R: GGCGCATTTCGTCTTCCTGG
UBXN1-t DQ811786.2 Construction of pET-28a-UBXN1 F: TCGGTCGACTCAACTGGGACA-CTTCTT
R: GCGGTCGACTTAGTTTGTCTAATAATA