Skip to main content

Advertisement

Table 1 Primers used in this study

From: Thioredoxin H (TrxH) contributes to adversity adaptation and pathogenicity of Edwardsiella piscicida

Primer Sequences (5′ → 3′)
TrxhKOF1 GGATCCCTCAACTTGCCAATACCAT (BamHI)
TrxhKOR1 TCACCGATGCTAGCGGCCTGTACGG
TrxhKOF2 CCGCTAGCATCGGTGAAACGTCGCCA
TrxhKOR1 GGATCCATGCCGATCGCCATCAGC (BamHI)
TrxhF3 GGATCCCTGAGTATTGCCGAGC (BamHI)
TrxhR3 CATATGGCGGGTCAGAAAGTCAGAGA (HindIII)
TrxhRTF AAACGGCAGGAGCGTGAA
TrxhRTR GGGTGCTTTGCTGGCTGA
TrxARTF GAGTATGCAGGGAAGCTGACCAT
TrxARTR GGTTGGCATCCAGGAACTCTTT
TrxCRTF TCCCGCCTGTCATACCACCA
TrxCRTR GCGCCCAGAAGTCGATCAGTA
TrxhPF4 GATATCATTCAGCCCGGCAAAGAC (EcoRV)
TrxhPR4 GATATCATCCCACCTTTTTGTAATGTTC (EcoRV)