Skip to main content

Table 1 Quantitative real-time PCR primers used in this study

From: Nuclear localization of Newcastle disease virus matrix protein promotes virus replication by affecting viral RNA synthesis and transcription and inhibiting host cell transcription

Gene name Forward primer (5′ → 3′) Reverse primer (5′ → 3′) GenBank no.
NDV M CTGTGCTTGTGAAGGCGAGAGGT TGGGGAGAGGCATTTGCTATAGGAT KP742770
PROX1 GCAGGTCAGACAACGAGATGTGC AGGAATTTGGCCCTTGGTCCTTC NM_001005616
AHRR TCATCACGAAGGTGCAGCTTTCG TGCTGTTGGGCAACAACATATTCTG HQ340610
RARA AGAGCACCAGCTCAGAGGAGATCGT ACCCCATAGTGGTACCCGGAGGAT NM_204536
ZEB2 CAGCGACACAGCCATTATTTACCCC AGTTCCAGGTGGCAGGTCGTTTTC NM_001318466
PAIP2 AGCCCAAGCATCATCAGTGAAGATG CCACAACTCCTCTTCAATCTGCCTG XM_025154840
RUNX2 ACCACAGAGCCATAAAGGTGACG GGGACCCCTACTCTCATACTGGGA NM_204128
AHR GCGTAACATGAAGTTGCCCTTCATG GTTTTGCCTCCTTTTCCTGTGGTG NM_204118
HOXB4 GTTCCCACCCTGTGAAGAGTATTCC TCATGTTGGAAAGTGCTCTCTCGC NM_205293
NF1A AACCCGAGGTAAAGCAGAAATGG GAGGCTTTTTTCCTGTGACTGTGAG NM_205273
IRF2 GAGCCAGTTGAATCATCTTTTGGGA CAAGGTGCGGCTGTCCTACAACTA NM_205196
TAF9 TGATGGCGCAGATCCTGAAGGATA GTAAATCTTCGCGTCCTCCAGGATG NM_001277796
LHX2 GGAGATTTTCGGTGCAGAGATGTGC GTGGTCAGCATCTTGTTGCAAGTGG NM_204889
GAPDH TCAAGGCTGAGAACGGGAAACTTG TGGACTCCACAACATACTCAGCACC NM_204305