Skip to main content

Table 1 Primer and probe sequences for Treponema species-specific fourplex qPCR and conventional PCR

From: Associations between digital dermatitis lesion grades in dairy cattle and the quantities of four Treponema species

Species Forward primer (sense) Probe (sense) Reverse Primer (antisense) Size (bp)
T. denticola a GGAAACTTAGGAATTCGATATGTAG AGCATACAGCGATTATAACAAAGCCCTCGA CCTTCTTTAGTTTCTTTGTGAGG 113
T. medium a AAAGCGCTACGAATCCTAAG TGCACCCTTGTTTACTACTGCACAGCC ATCATTACCCGTCCACAAAG 119
T. phagedenis a CCCGCAGGAAGGTATAATC AATCCGCCTACGACTGCGATACCA CACAGCTGTTGTGGTATTAAG 90
T. pedis a ACACCGATTGTACTGAATGA ACTACACGTGGAGTACCGAATGCT CCACGAGCTTTCTACAGATT 118
T. denticola b AGGAATGGCCTTTGAACCCGCA   CCGATGAACCCGTATCTTCACCGA 458
T. medium b GGAACAGGCAGCCGCATTGGAT   CCGCCCATGTGAGGCTTGTGAT 515
T. phagedenis b TCCGCCTACGACTGCGATACCA   CGGAACTGTCACAACTGGCGGA 785
T. pedis b TGGATGTTACGGAAGAGACACCGA   TGCCCCACTCTTACAAGTTCATCCCA 295
  1. aPrimer and probe sequences for species of Treponema for qPCR.
  2. bConventional PCR primer sequences for Treponema species.