Skip to main content

Table 1 Primers used for expression plasmid construction

From: Annexin A2 binds to vimentin and contributes to porcine reproductive and respiratory syndrome virus multiplication

Primers Sequences (5′ to 3′)
pFU-ANXA2-F CGCGGATCC ATGTCTACCGTTCATGAAATTCT
pFU-ANXA2-R TAACACCGGTTCAGTCATCCCCACCACACAG
pANXA2-F TTGGGCCCACCATGTCTACCGTTCATGAAATTCT
pANXA2-Flag-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCGTCATCCCCACCACACAG
pVIM-F TTGGGCCCACCATGACCACCAGGTCCGTGTC
pVIM-HA-R CCGGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTATTCAAGGTCATCGTGATGC
ANXA2-Flag(1–102)-F TTGGGCCCACCATGTCTACCGTTCATGAAATTCT
ANXA2-Flag(1–102)-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCTAGGCCCAAAATCACTGTC
ANXA2-Flag(1–174)-F TTGGGCCCACCATGTCTACCGTTCATGAAATTCT
ANXA2-Flag(1–174)-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCCAGGGCAACCATCAGCTTG
ANXA2-Flag(1–259)-F TTGGGCCCACCATGTCTACCGTTCATGAAATTCT
ANXA2-Flag(1–259)-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCCAGGTTCAGGAAAGCATTTT
ANXA2-Flag(109–340)-F TTGGGCCCACCATGTATGACGCTTCCGAGCTGAAA
ANXA2-Flag(109–340)-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCGTCATCCCCACCACACAG
ANXA2-Flag(192–340)-F TTGGGCCCACCATGCAAGATGCCCGGGATCTCTAT
ANXA2-Flag(192–340)-R CCGCTCGAGTCACTTATCGTCGTCATCCTTGTAATCGTCATCCCCACCACACAG