Skip to main content

Table 1 Primer sequences for qRT-PCR analyses of cytokine transcripts

From: Host-specific differences in the response of cultured macrophages to Campylobacter jejuni capsule and O-methyl phosphoramidate mutants

Gene Forward primer Probe Reverse primer Accession no.
Chicken
 28S GGCGAAGCCAGAGGAAACT AGGACCGCTACGGACCTCCACCA GACGACCGATTTGCACGTC AH001604
 IL-1β GCTCTACATGTCGTGTGTGATGAG CCACACTGCAGCTGGAGGAAGCC TGTCGATGTCCCGCATGA NM_204524
 IL-6 GCTCGCCGGCTTCGA AGGAGAAATGCCTGACGAAGCTCTCCA GGTAGGTCTGAAAGGCGAACAG NM_204628
 CXCLi1 TGGCTCTTCTCCTGATCTCAATG TCGCTGAACGTGCTTGAGCCATACCTT GCACTGGCATCGGAGTTCA Y14971
IL-10 CATGCTGCTGGGCCTGAA CGACGATTCGGCGCTGTCACC CGTCTCCTTGATCTGCTTGATG NM_001004414
Human
 28S GAATTCATGGACGACACGAG   ACTGTGACAGACCATTCCCA NR_003279
 IL-6 CCAGAGCTGTGCAGATGAGT   CTGCGCAGAATGAGATGAGT NM_000600
 IL-10 GAGGCTACGGCGCTGTCAT   TGCTCCACGGCCTTGCT NM_000572
Mouse
 β-actin TCCAGCCTTCCTTCTTGGGT   GCACTGTGTTGGCATAGAGGT NM_007393
 IL-6 GGGACTGATGCTGGTGACAACC   GGAGAGCATTGGAAATTGGG NM_031168
 IL-10 CGATGACGGGCCAGTGAGAATG   TCAACACGTGGGCAGGATAGGCT NM_010548