Skip to main content

Table 1 Mutagenesis primers for the hemagglutinin gene

From: Glycosylation at 11Asn on hemagglutinin of H5N1 influenza virus contributes to its biological characteristics

Mutation Direction Primer sequence (5′-3′)
SY S10A Forward CATGCAAACAACGCGACAGA
Reverse TCTGTCGCGTTGTTTGCATG
SY T11A Forward CATGCAAACAACTCGGCAGA
Reverse TCTGCCGAGTTGTTTGCATG
SY ST10/11AA Forward CATGCAAACAACGCGGCAGA
Reverse TCTGCCGCGTTGTTTGCATG
  1. The substitution nucleotides are underlined.