Skip to main content

Table 1 List of the genes selected for the quantitative real time RT-PCR validation

From: Distinct functional enrichment of transcriptional signatures in pigs with high and low IFN-gamma responses after vaccination with a porcine reproductive and respiratory syndrome virus (PRRSV)

Gene name Sequence of the primers Ensembl ID Primer position Description
GBP2 F: CCTGTGGTGGTGGTGGTTAT ENSSSCG00000006923 Exon 3–4 Guanylate binding protein 2, interferon-inducible
R: AGATGCCCTTCGTGTGAGAC
IL1A F: CAAGGACAGTGTGGTGATGG ENSSSCG00000008090 Exon 4–5 Interleukin 1, alpha
R: GTTGCTGATCTGGGCTTGAT
IL8 F: CCTTCTTGGCAGTTTTCCTG ENSSSCG00000008953 Exon 1–2 Interleukin 8
R: AATTTGGGGTGGAAAGGTGT
CCL4 F: CATGAAGCTCTGCGTGACTG ENSSSCT00000019264 Exon 1–2 Chemokine (C–C motif) ligand 4
R: ACGGTGTATGTGAAGCAGCA
SAA1 F: ACTATGATGCTGCCCAAAGG ENSSSCT00000014601 Exon 1–2 Serum amyloid A1
R: ACTCCGTGGCCACTGTCTC
IGF1 F: AGTTCGTGTGCGGAGACAG ENSSSCT00000000935 Exon 2–3 Insulin-like growth factor 1
R: GCCTCCTCAGATCACAGCTC
CCL2 F: CTTCTGCACCCAGGTCCTT ENSSSCT00000019290 Exon 1–2 Chemokine (C–C motif) ligand 2
R: TGCTGCTGGTGACTCTTCTG
IL1B F: AGTGGAGAAGCCGATGAAGA ENSSSCT00000008861 Exon 4–5 Interleukin 1, beta
R: CATTGCACGTTTCAAGGATG
LTBP1 F: GGGAACACCACCACTCTCAT ENSSSCT00000009313 Exon 1–2 Latent transforming growth factor beta binding protein 1
R:TTGTCCCTTGAACTGCACTG