Skip to main content

Table 1 Sequences of the primers used for real-time PCR and the siRNA against chGRP78

From: Membrane-associated GRP78 helps subgroup J avian leucosis virus enter cells

  Name Sequence(5′–3′)
RT-PCR ALV-J gp37 Forward: TGCGTGCGTGGTATTATTTC
Reverse: AATGGTGAGGTCGCTGACTGT
chGRP78 Forward: GACGATGAGGAGAAAAAGGAG
Reverse: TGAATACACCCACACAAGAAT
Chicken 18s Forward: TCAGATACCGTCGTAGTTCC
Reverse: TTCCGTCAATTCCTTTAAGTT
Human β-actin Forward: CACGAAACTACCTTCAACTCC
Reverse: CATACTCCTGCTTGCTGATC
siRNA 366 Forward: AGGACAUCAAGUAUCUGCCCUUCAA
Reverse: UUGAAGGGCAGAUACUUGAUGUCCU
611 Forward: GGGUUGAACGUGAUGCGCAUUAUUA
Reverse: UAAUAAUGCGCAUCACGUUCAACCC
519 Forward: CCCACAGAUUGAAGUUACCUUUGAA
Reverse: UUCAAAGGUAACUUCAAUCUGUGGG