Skip to main content

Table 1 List of primers used in this study

From: Immune protection of chickens conferred by a vaccine consisting of attenuated strains of Salmonella Enteritidis, Typhimurium and Infantis

Gene Gene function Orient Primer 5′–3′
AH221 CC type chemokine For CTCTGCTCCTCGGCTGTG
   Rev TCCTTCCCTTTCTTGGTCAC
AVD Avidin For CCTTTGGCTTCACTGTCAAT
   Rev GCGAGTGAAGATGTTGATGC
CSF3 Colony stimulating factor 3 For AACCTCTCCTCCAACATCCAG
   Rev GTACGCCGTCTCCAGGAAG
ES1 ES1 protein homolog, mitochondrial-like For GGTGTACGATGGCAGTGAGAT
   Rev CTCTGGCTATTCTGGCACTTTC
ExFABP Extracellular fatty acid binding protein For GGAACTACACGGATGAGATGGT
   Rev TGGCACATTAGTCTTGCTTTGT
IgG IgG (IgY) immunoglobulin For GGGAGAAGAGTGGGAACCTC
   Rev ATAACCAATCCTGGGTGCTG
IL22 Interleukin IL-22 For CAGGAATCGCACCTACACCT
   Rev TCATGTAGCAGCGGTTGTTC
IL4I IL4-inducible gene For GGAGAAGGACTGGTATGTGGAG
   Rev GCTTCAGGTCAAACTGCCTTAT
IL8 Interleukin IL-8 For CAAGCCAAACACTCCTAACCAT
   Rev AGCTCATTCCCCATCTTTACC
INFγ Interferon γ For GCC GCA CATCAAACACATATCT
   Rev TGAGACTGGCTCCTTTTCCTT
iNOS Inducible NO synthase For GAACAGCCAGCTCATCCGATA
   Rev CCCAAGCTCAATGCACAACTT
IRG1 Immune responsive gene 1 For TCGTCGAAATCCATTGAGTG
   Rev ACCGAGGTCTGCCAGAAAGT
LYG2 Lysozyme G2 For GGGCACGAGAATACTTATTGACA
   Rev TCATTGCTGTAGTCATCATGGAG
MMP7 Matrix metalloproteinase 7 For GATGATGCAATTAGAAGGGCTTT
   Rev CCACCTCTTCCATCAAAAGGATA
MRP126 Protein MRP-126 For TGAAGCTCTTGATTGAGAAGCA
   Rev CGAGATCCTTGAAGATTTGGTC
PTGDS Prostaglandin D2 synthase For CATTCCTGTGCAAGCTGACTT
   Rev CTGTTCCTCTTCTCGCACTGTT
SAA Serum amyloid A For GCTTCGTGTTGCTCTCCATT
   Rev TAGTTTGCCTCACGCATGTC
SCYA4 Small inducible cytokine A4, MIP-1β For TCATGCTGGTGTTGTGTTCA
   Rev GGTGCATCAGTTCAGTTCCA
SERPINB10 Serine protease inhibitor For AGACTCAGGTCTTCTCTCTCACG
   Rev TGTTGGTCTCATTCAGCTTGTT
TGM4 Transglutaminase 4 For GCCTTCAACATACACAGCAAAC
   Rev CAGACATGGCTCTGGATACAAC
TRAP6 Trappin 6 For CACGGGGACACAGGCACCCTT
   Rev CCACCCACCATCCCCTTGTCC