Skip to main content

Table 1 Primers used to quantify gene expression in mock or IFN-treated CEF using real-time qRT-PCR

From: Chicken interferome: avian interferon-stimulated genes identified by microarray and RNA-seq of primary chick embryo fibroblasts treated with a chicken type I interferon (IFN-α)

Gene Accession number Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH NM_204305.1 GGCACTGTCAAGGCTGAGAA TGCATCTGCCCATTTGATGT
IFNβ NM_001024836.1 CAGTCTCCAGGGATGCACAG GAGAAGGTGGTGGTGAGAGC
MX1 NM_204609.1 CACACCCAACTGTCAGCGAT ATGTCCGAAACTCTCTGCGG
IFIT5 XM_421662.4 TGCTTCACCAGCTAGGACTCTGC TGGCTTTTGCTCTGTCACCACTTTG
ZC3HAV1 NM_001012938.1 TCGGCGCCTCTCTACGCCAT TCAGTCCACTGGCCGTGGTCA
IRF8 NM_205416.1 ACAAGCAGGGCATCTTCATC TGTTCCCACTCCAGAAGACC
SOCS1 NM_001137648.1 CTGCTGGATGCCTGCGGCTT GGGCCCGGTCGCGGTTTTAA
IL15 NM_204571.1 CACTGTAAGTGGTCAGACGTTCTGA GGTTCCTGGCATTCTATATCCTCGT
RSAD2 XM_426208.4 GGACAAGGACGAGACAGTTCC TCCCGCCTCCTTAAGCATTG
TRIM25 XM_415653.5 TCAAGAGTCCCACCCTTCCA AGCAGCTCAATGGACAGCAT
LGP2 HQ845773.1 ATCTCGCGGCATTGTCTTCA CTGCTGCTCATTCTGGGTCA