Skip to main content

Advertisement

Table 1 Primers used in this study.

From: Apramycin treatment affects selection and spread of a multidrug-resistant Escherichia coli strain able to colonize the human gut in the intestinal microbiota of pigs

Primers Sequence (3′–5′)
aac(3)-IV-F AGTTGACCCAGGGCTGTCGC
aac(3)-IV-R GTGTGCTGCTGGTCCACAGC
blaTEM-F TTTGCGGCATTTTGCCTTCCT
blaTEM-R GTTCATCCATAGTTGCCTGAC
strA-F TTG ATG TGG TGT CCC GCA ATG C
strA-R CCA ATC GCA GAT AGA AGG CAA
sul-2-F TTTCGGCATCGTCAACATAA
sul-2-R GTGTGTGCGGATGAAGTCAG
tet(X)-F TTAGCCTTACCAATGGGTGT
tet(X)-R CAAATCTGCTGTTTCACTCG