Skip to main content

Advertisement

Table 2 Nucleotide sequences of primers and probes used in this study

From: Piscine orthoreovirus (PRV) in red and melanised foci in white muscle of Atlantic salmon (Salmo salar)

Target Primer/probe Sequence (5’ → 3’) Reference
PRV S1 Fwd TGCGTCCTGCGTATGGCACC [20]
S1 Rev GGCTGGCATGCCCGAATAGCA
S1 Probe ATCACAACGCCTACCT
SAV nsP1-Fwf CCGGCCCTGAACCAGTT [27]
nsP1-Rev GTAGCCAAGTGGGAGAAAGCT
nsP1-Probe CTGGCCACCACTTCGA
ILAV S7 Fwd TGGGATCATGTGTTTCCTGCTA [30]
S7 Rev GAAAATCCATGTTCTCAGATGCAA
S7 Probe CACATGACCCCTCGTC
IPNV VP3 Fwd CGACCGACATGAACAAAATCA [28]
VP3 Rev AGTTGCAGCTGTATTCGCACA
VP3 Probe TCTAGCCAACAGTGTGTACGGCCTCCC
VHSV N Fwd GACTCAACGGGACAGGAATGA [29]
N Rev GGGCAATGCCCAAGTTGTT
N Probe TGGGTTGTTCACCCAGGCCGC
PMCV Fwd TTCCAAACAATTCGAGAAGCG [25]
Rev ACCTGCCATTTTCCCCTCTT
EF 1αβ Fwd TGCCCCTCCAGGATGTCTAC [25]
Rev CACGGCCCACAGGTACTG
Probe AAATCGGCGGTATTGG