Skip to main content

Table 2 Oligonucleotide primers used for multiplex PCRs to detect 16 genes putatively linked with virulence of E. rhusiopathiae

From: A combinational approach of multilocus sequence typing and other molecular typing methods in unravelling the epidemiology of Erysipelothrix rhusiopathiae strains from poultry and mammals

Gene / locus tag Gene product / predicted function [reference] Primer sequence (5′ – 3′) (forward/reverse)a GenBank Acc. No Localization within gene Size (bp) Gene pre-valence (%)
ERH_1356 ABC transporter metal-binding protein / adhesion of host cells [45] CATGAAGGGTAACACCTTGG/ GGGCGATAAAGTTGCGGTAGAA NC_015601.1 579 – 787 209 100
intI-like Internalin / invasion of epithelial cells [18,45] ACAGTTTCGGATACTTCCGG/ ACCCTCGTCATATTTACCAGC AP012027.1 386 – 714 329 85.5
rspB Rhusiopathiae surface protein /biofilm formation [41] ATCTTTACCCAATTCGACGT/ ATGAACCCAGTCCAAGATTGG AB052682.1 6882 – 7287 406 100
rspA Rhusiopathiae surface protein /biofilm formation [41] ATCGACTGGTATTCAGTTGG/ ATCACGAGACATACCGCCAA AB052682.1 597 – 1131 535 100
cap locus Capsule / resistance to phagocytosis, intracellular survival [40] TATCTTTGTAGCGTAGTTGG/ CAATAAAAGGAAATACCAGTGC D64177 1333 – 1987 645 100
algI Alginate-O-acetyltransferase / resistance to phagocytosis [45] AGTTATCTTGGACTTGGTCC/ AGATAAGTGCGCATTGATCC AP012027.1 121 – 887 767 97.6
ewlA Lipoprotein / adhesion to host cells [45] TAATATTAGATAGCGAGGAAT/ AAGAAAAGGGAGTGTGAATAT U52850.1 226 –1185 960 100
nanH Neuraminidase / spreading factor, nutritive [44] ATGAAGCGCTTACATTTGAAT/ TACATAAGGTTGACCAAAGTC AB019122 295 –1401 1.107 100
sub S8-subtilisin / peptidase [45] AAGCCTGAGATATCTGCACC/ TTGTACAATTGGATGAGCCG AP012027.1 1360 –1585 226 100
sodA Superoxide dismutase / antioxidans [45,70] AGAAGACATCCGCACAGCAGT/ GCATGTTCCCAAACATCAAGA AP012027.1 195 – 509 315 100
mviN1 Integral membrane protein / cell adhesion, transport protein [45] AAATCATGCTTGTAATGGCGG/ ATTCGACGTTAAAACAACCGC AP012027.1 565 –1032 378 100
hep Heparinase / inactivation of heparin [45] ATGGAAGTACCGATCTCACT/ TCATTGTAGCAACATGGCTTC AP012027.1 997 –1480 484 100
hlyIII Hemolysin / lytic activity on red blood cells [42] TACGATTGCGACAAAGTGTGCG/ ATGGAAACATAGGGAAGGCTG AP012027.1 16 – 559 544 100
fbpA Fibronectin-binding protein / adhesion [41] ATCTCGCCGCTTTTAGAACG/ GCGTCTTCAACTGTTGCTTG AP012027.1 565 –1166 602 100
hlyA Hyaluronidase / spreading factor [2] AGGATCACTTACCGCTATGG/ CAGCACTCAGCATGTTCTC AP012027.1 598 –1538 941 100
dnaB Membrane-, attachment protein / proliferation, adhesion [45] AATAGCCCCTGATCAAATGG/ CTCTCCTTTACTTAACATCCC ACLK02000002.1 39 –1155 1.117 99.4
  1. Primers were designed in this study except for the primers to amplify the cap locus [46].
  2. aIn case Ogawa et al. [45] is given as a reference, the predicted function of the gene product has been deduced from genome annotation data of strain Fujisawa. Here, in vitro or in vivo studies would be mandatory to verify the linkage of the genes with the pathogenesis of Erysipelas in different hosts.