Skip to main content

Table 1 Primers used to generate mutations in the NA gene of SD01 virus

From: Amino acid substitutions in the neuraminidase protein of an H9N2 avian influenza virus affect its airborne transmission in chickens

Mutation Primer sequence (5’-3’)
Forward Reverse
D368E&S370L TGGATGGGACGGACAATCAAAGAGGATTTACGCTCAGGTTA TAACCTGAGCGTAAATCCTCTTTGATTGTCCGTCCCATCCA
E313K GTTCTATATATAAATATGGCAGATTATAGTATTAAGTCCAGTTATGTGTGC GCACACATAACTGGACTTAATACTATAATCTGCCATATTTATATAGAAC
G381D CTTTCAGGGTCGTTGATGGTTGGACCACGGC GCCGTGGTCCAACCATCAACGACCCTGAAAG
  1. The changed nucleotides are in boldface.