Skip to main content

Table 1 PCR primers used for the amplification of B. hyodysenteriae plasmid genes not on the GeneChip

From: Absence of a set of plasmid-encoded genes is predictive of reduced pathogenic potential in Brachyspira hyodysenteriae

Primer namea Sequence (5′ – 3′) Product size
BHWA1_02666a-F gagaagaatatttaatacctttaatag 217 bp
BHWA1_02666a-R cattcatatatataataataatggttgg  
BHWA1_02666b-F ccaaccattattattatatatatgaatg 549 bp
BHWA1_02666b-R ctaaatctctatattgtttaactatag  
BHWA1_02666c-F ctatagttaaacaatatagagatttag 177 bp
BHWA1_02666c-R ctatttttatacctaatatggtgaatat  
BHWA1_02667a-F actggagttgctggatttataggatc 560 bp
BHWA1_02667a-R aagtcaggtctctgtctctttcc  
BHWA1_02667b-F caaataaagatcatactgttataggaatag 597 bp
BHWA1_02667b-R atgtatagtcacgcatagtgg  
BHWA1_02667c-F tgtaatacatttagcaggatatgg 384 bp
BHWA1_02667c-R ggtataggattattttcaagtatcag  
BHWA1_02668a-F gttcataccatttagaaaaagaagag 701 bp
BHWA1_02668a-R gttcataccatttagaaaaagaagag  
BHWA1_02668b-F agaacaaaacaacataaagcatc 206 bp
BHWA1_02668b-R catcagtaaaacaaatataatccc  
BHWA1_02668c-F cctgagcattatggactttc 240 bp
BHWA1_02668c-R tgtactgtctgattttttatggtc  
BHWA1_02672a-F aaatgtagaagatattgtattgcc 417 bp
BHWA1_02672a-R acctctcctatatgttttttatacttag  
BHWA1_02672b-F attactacaaaatgtactctaaaatgtaag 546 bp
BHWA1_02672b-R ccatactatatgacaaaaataaaatctag  
BHWA1_02672c-F tatctaagtataaaaaacatataggagagg 498 bp
BHWA1_02672c-R cagcacaaaactcacatagtg  
BHWA1_02673a-F aaatacttgtcaataatcttagtgg 1819 bp
BHWA1_02673a-R tttcatcataagcaaaaataatatc  
BHWA1_02673b-F gtaagtggaaaaagaatgaaacatac 1032 bp
BHWA1_02673b-R agattgtcttgacgaataaaag  
BHWA1_02673c-F aataaatatgacattaaaggaataaaaatc 805 bp
BHWA1_02673c-R ctattgttagtagcaaaataataaaaatac  
BHWA1_02674a-F atttagaagatgtaatacctttagagg 249 bp
BHWA1_02674a-R tcattttcgctatatttttatttac  
BHWA1_02674b-F ttatacaaaataggagagcctttag 363 bp
BHWA1_02674b-R atcgcaataatctgaaaatg  
BHWA1_02674c-F gtatgtacttatcttttttattctattgtc 194 bp
BHWA1_02674c-R catattggatttttatctctatgtc  
BHWA1_02675a-F attggatagaacatagagggag 301 bp
BHWA1_02675a-R actgtatcatttgctatttcattag  
BHWA1_02675b-F tataaaaactataagaatatctctacaagg 367 bp
BHWA1_02675b-R aacatataaggtataaaatggttgag  
BHWA1_02675c-F cctcaaccattttataccttatatg 184 bp
BHWA1_02675c-R taactatattttctcgttttccttg  
  1. aPrimers named according to the plasmid gene they are designed to amplify.