Skip to main content

Table 1 Bacterial strains, plasmids and primers used in this study

From: Lack of a type-2 glycosyltransferase in the fish pathogen Flavobacterium psychrophilum determines pleiotropic changes and loss of virulence

Plasmid, bacterial strain or primer Description or sequence Source or reference
Plasmidsa   
pEP4351 Ori R6K dependent protein pir,; RP4 oriT; Cmr Tcr (Emr); Tn4351 vector transfer. [39]
pCP23 ColE1 ori, (pCP1 ori), Apr (Tcr), E. coliF. psychrophilum shuttle plasmid [40]
pCP23-fpgA FP1638 gene, derived from pCP23. This study
pCP23-Gfpp2 pCP23-G carrying fpp2-fpp1 promoter [41]
Bacterial strains   
F. psychrophilum   
THC02/90 Wild-type. [42]
fpgA FP1638 mutant created by Tn4351 transposition. This study
fpgA+ Mutant ΔFP1638 carrying pCP23-FP1638 plasmid, complemented strain. This study
THC02/90-G THC02/90 strain carrying pCP23-G plasmid [41]
THC02/90 -fpp2 THC02/90 strain carrying pCP23-Gfpp2 plasmid [41]
fpgA -fpp2 ΔFP1638 strain carrying pCP23-Gfpp2 plasmid [41]
E. coli   
S17-1 λpir λpir hsdR pro thi; RP4-2 Tc::Mu Km::Tn7 [34]
BW19851 RP4-2tet::Mu-1kan::Tn7 integrant; _uidA::pir_ recA1 hsdR17 creB510 endA1 zbf-5 thi [35]
Primersb   
26-F 5′ACTGGGATCCAGTTTTAAGCCCGCAAA 3′ This study
26-R 5′ ACTGCTGCAGCAATGAACTTCGTCTTG 3′ This study
TN-1 5′ GGACCTACCTCATAGACAA 3′ [19]
IS4351-F 5′ TCAGAGTGAGAGAAAGGG 3′ [19]
promfpp2-F 5′ ATCAGGATCCGAGCACTACACTTTCTAGA 3′ [41]
promfpp2-R 5′ GATTGGATCCTGTTCGGTAGTGTAGCA 3′ [41]
  1. aAntibiotic resistance phenotypes: ampicillin, Apr; tetracycline, Tcr; erythromycin, Emrb. Antibiotic resistance phenotypes and other features listed in parentheses are those expressed by F. psychrophilum but not by E. coli.
  2. bRestriction sites for cloning are in bold.