Skip to main content

Table 2 Primers used for SNP identification of five suspected FIP-associated SNPs in Birman cats

From: Polymorphisms in the feline TNFA and CD209 genes are associated with the outcome of feline coronavirus infection

SNP name Chr-SNP positiona Orientationb Sequence (5′ - 3′) TAc Amplicon size
A1.196617776 A1-154265118 F GGCAGTCAGAGAATGAGACAC 61 °C 337 bp
   R TTGCCAGTTCTGCAGATTG   
A1.206840008 A1-164728174 F AGGTGAAGTGTTGTGTGCAT 61 °C 388 bp
   R ATGTTCTGCTAGATGAGCCG   
Un.59861682 A1-155715831 F CTCATCCCAGTTGATCACAC 61 °C 230 bp
   R TTCCTCCTGGAAAACCCT   
A2.191286425 A2-126618108 F AGCGTATCAAGTGCCTGC 61 °C 299 bp
   R CCTTCCTGTTTAGGTGCTTG   
E2.65509996 E2-54165589 F CGCTTCAGTTTCCTTTCCAG 61 °C 417 bp
   R TCTGAGCCTTGGTCTTCTG   
  1. aChr: chromosome.
  2. bF: forward; R: reverse.
  3. cAnnealing temperature.