Skip to main content

Table 2 Primers and probe used in this study

From: Natural and experimental hepatitis E virus genotype 3 - infection in European wild boar is transmissible to domestic pigs

Region Primers and probe Position Sequence Product length
ORF 3 Forward primer1 (HEV.Fa) 5278-5294 GTGCCGGCGGTGGTTTC 81 bp
Forward primer2 (HEV.Fb) 5278-5296 GTGCCGGCGGTGGTTTCTG
Reverse primer (HEV.R) 5340-5359 GCGAAGGGGTTGGTTGGATG
Probe (HEV.P) 5300-5320 FAM-TGACMGGGTTGATTCTCAGCC-BHQ1
  1. ORF = open reading frame.