Skip to main content

Table 1 Primers used in this study (*invitrogen oligo perfect designer used; # pyrosequencing assay design software version 1.0 used;$primer sequences obtained from[38]

From: Phenotypic and genotypic analysis of benzimidazole resistance in the ovine parasite Nematodirus battus

Oligo 5′3′
Gen Beta-tub For1* ATGCGTGARATCGTYCAY
Gen Beta-tub Rev1* CGAGGGAARGGKACCAT
HcPy2 PCR For$ GACGCATTCACTTGGAGGAG
HcPy2PCR Rev$ Biotin-CATAGGTTGGATTTGTGAGTT
Nb B-t200 Fbio# Biotin- AGGTAGGTGTGGCCTATCAAAAT
Nb B-t200 Rev# ATGTTCGGAAACAGATGTCGTAC
Nb B-t200 Seq# TTCGTTGTCAATGCAG