Skip to main content

Table 1 Oligonucleotide primers used for either RT-PCR or cycle sequencing of the VP1 region from the FMDV isolates

From: Phylodynamic reconstruction of O CATHAY topotype foot-and-mouth disease virus epidemics in the Philippines

Primer designation Primer sequence (5' to 3') Start - end
Reverse primers
NK72 GAAGGGCCCAGGGTTGGACTC 3558 – 3578
EUR-2B52R GACATGTCCTCCTGCATCTGGTTGAT 3624 – 3649
O-1D487gR TAATGGCACCRAAGTTGAA 3372 – 3390
O-1D628R GTTGGGTTGGTGGTGTTGT 3181 – 3199
Forward primers
O-1C244F GCAGCAAAACACATGTCAAACACCTT 2469 – 2494
O-1C272F TBGCRGGNCTYGCCCAGTACTAC 2497 – 2519
O-1C283F GCCCAGTACTACACACAGTACAG 2508 – 2530
O-1D296F ACAACACCACCAACCCAAC 3181 – 3199
O-1C499F TACGCGTACACCGCGTC 2724 – 2740
O-1C605hF TGGCCAGTGCCGGTAAGGACTTTGAC 2830 – 2855
O-1C605nF TGGCTAGTGCTGGCAAAGACTTTGAC 2830 – 2855
  1. Start and end locations have been mapped against the Kaufbeuren/FRG/66 type O FMDV isolate (GenBank accession no. X00871) [22].