Skip to main content

Table 4 Nucleotide sequences of the new F17 variants genes f17Ae , f17fAf and f17G3

From: Identification and detection of three new F17 fimbrial variants in Escherichia coli strains isolated from cattle

Variant gene Nucleotide sequence GenBank accession number (nucleotides)
f17Ae ATGCGGAAAATTCAATTTATCCTTGGAATACTGGCGGCTGCGTCATCTTCTGCTACGCTTGCTTATGACGGTACAATTACTTTTAATGGAAAAGTTGTTGCTCAGACTTGTTCTGTTTCATCAGGAAGCAAGAATTTAACCGTTACATTACCGACTGTTTCTGAAGCTTCATTGGCTGCCGCAACAAATACTGCAGGTCTGACTCCATTTACCATTGAGCTGACCGGGTGTGATACCAATGCAGCTTCTGGTGCTCAGAACGTAAAAGCTTATTTTGAACCTAACGCCACGACTGATTACGATACGGGTAATCTAAATATTGCTGCCAGTGGTGCAAATAACGTTCAGATACAGCTTCTAAATGCAGATGGAGTTACTCCAATAAAACTAGGCCAAGATGCTACAGGACAGAATGTTACAGCTGTACAGATTGATAACGCAGCTATGAAACTGCGTTATAATGCACAATATTATGCCACAGCTCAGGCTACAGCTGGTGATGTCTCTGCCACAGTAAATTACACCATCGCGTATCAGTAA AFDZ01000020.1 (420293-420832)
f17Af ATGCAGAAAATTCAATTTATCCTTGGAATACTGGCGGCTGCGTCATCTTCTGCTACGCTTGCTTATGACGGTACAATTAATTTTACTGGGAAAGTCGTTGATCAAACTTGTTCTGTTACTACAGGAACCGCTCCCTTGGCAGTTACACTACCAACTGTCTCCACAAAATCATTAGATTCAACCGGGAAGGTAGCAGGCCTTACTCCTTTCACAATTTCACTGAGTGGGTGTAATACTGCTGCCGCTACAGGAGCTCAAAGTGTGAAGGCTTATTTTGAGCCTAATGCGACCACTGATTATGATAGCCATAACCTTAATATTTCAAGTAGTGGCTCTGGTAACGCAACAAATGTCCAGATTCAGCTTCTGAATGCTGATGGTACCACACAGATACTACTTGGTAATGATTCTGCTACTCAGGGAGTAACACCTGTTGTTATTAATAATGACGCAATGACATTGCGTTATAACGCACGGTACTATGCAACAGGTCAGGCCACCGCCGGCAACGTTTCTGCCACTGTGAATTACACCATCGCTTATCAGTAA CP001162.1 (9749-10297)
f17G3 ATGATTTTCAGATATATCAGATTATTTTTAGTTGTACTTTGCAGTGTTGTTCTGGTTGACAGGGGAAACGCAGCATCTTTGTTTAATATCACGTTTGTCGGTAATGCTGAACAAACAATCACACCATCATCTGCATATACACTGACGCATGCAATGGATAATCTGCCTTACGTGTTCGATGAGGCGGGAGTAACTATTGGTTATTCCGCGGTTACTGTCTGGCAATATCCACGAGGGGTAAGAGTGTGTGCCGGGCTTGATGCAAAAGTTGGTTTACCCGTAGTGGGTAGCATTAATGGTCAGGATATCTATGGCGTCACTGATGAAGTGGGGCTGCTGGTATGGATGGGGGATGCCGGATATTCAGATGATGTTGCAATGACCGGAAATACGTGGACAAATGTACTGGATTCATGGTGTACAGCAAACGTTCCTCCAACGAGCCAGGGACTATCCCTTTATGTAAAACCTGTCATTCTTAAAAGAAGTACTACTGCTTCTTATGTTATCCCTCAGACGACAATAGGTAGTATTAAGTTTCGTCTGGAAGATGGGCCAAATAGTGGATATGAAACAACTGTCAATTTTACACTCAGTAGTTTTACGATTAACAATACAGTCACATCGTGCAGACTGTTGACGCCGGCATCCGTCAATGTTGCATTGCAGGACGTTTTTGTCAGTCAGTTTCCCTCTTCCGGTGATGAGGTTGCAGCCGGCTCCACGACGTTGCGGCTGCAGTGTGATGCAGGAGTGACGGTATGGGCAACACTGACTGATGCGACCACACCGTCCAACAGAAGCGATATACTCACACTGACGGGGGCATCGACTGCAACCGGAGTCGGGCTGAGAATATACAAGAACACTGACAGTTTGCCCCTGAAGTTTGGACCTGATTCGCCGGTAAAGGGAAATGAAAACCAGTGGCAGTTATCGTCAGGGACGGAAACGTTGCCCTCAGTTACCCTGAATGTAAAGTATGTTAATACCGGTGAGGGAATTAATCCGGGTACGGTCAACGGAATATCAACATTTACGTTTTCCTATCAGTAA AFDZ01000020.1 (424180-425235)