Skip to main content

Table 2 Oligonucleotide primers used for detection of the virulence-associated genes on E . coli isolates from feces of calves with diarrhea in Iran

From: Identification and detection of three new F17 fimbrial variants in Escherichia coli strains isolated from cattle

Gene/DNA fragment Primer sequence (5′ - 3′) Product size (bp) Reference
aap CTTGGGTATCAGCCTGAATG 310 [22]
AACCCATTCGGTTAGAGCAC
aggR CTAATTGTACAATCGATGTA 457 [22]
AGAGTCCATCTCTTTGATAAG
AA probe CTGGCGAAAGACTGTATCAT 629 [22]
CAATGTATAGAAATCCGCTGTT
f17A family GCAGAAAATTCAATTTATCCTTGG 537 [10]
CTGATAAGCGATGGTGTAATTAAC (P2)*
f17Aa GCTGGAAGGGTGCAATACGCCTG 321 [10]
f17Ab CAACTAACGGGATGTACAGTTTC 323 [10]
f17Ac GCAGGAACCGCTCCCTTGGC 416 [10]
f17Ad GATAGTCATAACCTTAATATTGCA 239 [10]
f17G1 CGGAGCTAATACTGCATCAACC 615 [10]
TGTTGATATTCCGTTAACCGTAC
f17G2 CGTGGGAAATTATCTATCAACG 615 [10]
TGTTGATATTCCGTTAACCGTAC
afa E-VIII CTAACTTGCCATGCTGTGACAGTA 302 [23]
TTATCCCCTGCGTAGTTGTGAATC
f5 TATTATCTTAGG TGGTATGG 314 [24]
GGTATCCTTTAGCAGCAGTATTTC
f41 GCATCAGCGGCAGTATCT 380 [24]
GTCCCTAGCTCAGTATTATCACCT
stx1 AGAGCGATGTTACGGTTTG 388 [25]
TTGCCCCCAGAGTGGATG
stx2 TGGGTTTTTCTTCGGTATC 807 [25]
GACATTCTGGTTGACTCTCTT
eaeA AGGCTTCGTCACAGTTG 570 [25]
CCATCGTCACCAGAGGA
stI ATTTTTMTTTCTGTATTRTCTT 190 [26]
CACCCGGTACARGCAGGATT
ltI GGCGACAGATTATACCGTGC 450 [26]
CGGTCTCTATATTCCCTGTT
ipaH GTTCCTTGACCGCCTTTCCGATACCGTC 600 [26]
GCCGGTCAGCCACCCTCTGAGAGTAC
papE-F GCAACAGCAACGCTGGTTGCATCAT 336 [27]
AGAGAGAGCCACTCTTATACGGACA
afaI B-C GCTGGGCAGCAAACTGATAACTCTC 750 [27]
CATCAAGCTGTTTGTTCGTCCGCCG
sfa/focDE CGGAGGAGTAATTACAAACCTGGCA 410 [27]
CTCCGGAGAACTGGGTGCATCTTAC
hly AACAAGGATAAGCACTGTTCTGGC 1177 [27]
ACCATATAAGCGGTCATTCCCGTCA
iucD TACCGGATTGTCATATGCAGACCG 602 [27]
AATATCTTCCTCCAGTCCGGAGAAG
cnf1 GGGGGAAGTACAGAAGAATTA 1111 [28]
TTGCCGTCCACTCTCACCAGT
cnf2 TATCATACGGCAGGAGGAAGCACC 1240 [28]
GTCACAATAGACAATAATTTTCCG
cdtIII GAAAATAAATGGAATATAAATGTCCG 555 [28]
TTTGTGTCGGTGCAGCAGGGAAAA
cdtIV CCTGATGGTTCAGGAGGCTGGTTC 350 [28]
TTGCTGCAGAATCTATACCT
clpG GGGCGCTCTCTCCTTCAAC 402 [29]
CGCCCTAATTGCTGGCGAC
chuA GACGAACCAACGGTCAGGAT 279 [30]
TGCCGCCAGTACCAAAGACA
yjaA TGAAGTGTCAGGAGACGCTG 211 [30]
ATGGAGAATGCGTTCCTCAAC
TspE4.C2 GAGTAATGTCGGGGCATTCA 152 [30]
CGCGCCAACAAAGTATTACG
  1. *P2 was used as common reverse primer for f17A family, f17Aa, f17Ab, f17Ac, f17Ad detection.