Skip to main content

Table 1 Primers used in this study a

From: Isolation and characterization of a subtype C avian metapneumovirus circulating in Muscovy ducks in China

Name Sequence (5′-3′) Position Target gene
N-F 5′ GGGACAAGTGAAAATGTCTCTTCAGGGGATTCA GCTTA 3′ 41-77 N
N-R 5′ TTTTTAATTACTCATAATCATTCTGGCCT 3′ 1235-1263
P-F 5′ GGGACAAGTCAAAATGTCCTTTCC 3′ 1248-1271 P
P-R 5′ GTTTTTTATTAACTACATAGTAAGGGAGTATAG GTCATC 3′ 2136-2174
M-F 5′ GGGGACAAGTIAAIATGGAGTC 3′ 2157-2175 M
M-R 5′ GTCTTGGCTATCGCTACACC3′ 3399-3418
F-F 5′ GGGACAAGTGAAAATGTCTTGG 3′ 3208-3229 F
F-R 5′ TCTTCACTTGTCCCAATTTTTT 3′ 4666-4687
M2SH-F 5′ TTGGGACAAGTGAAGATGTCTCG 3′ 4672-4694 M2-SH
M2SH-R 5′ CTTGACTTTGACTTTAAGCTCCTG 3′ 6186-6209
L1-F 5′ GGACCAAGTTAAAAATGGATCCAC 3′ 7939-7962 L
L1-R 5′ TACACTCCTTCTGTTTCTGGAGG 3′ 10006-10028
L2-F 5′ TGGCTGCATTTGACTGTTCCACT 3′ 9951-9983 L
L2-R 5′ CACTAAGTCCAATTTGTCAGGG 3′ 12068-12089
L3-F 5′ TACAGGCAGAAGCCCTAAACAAT 3′ 11933-11955 L
L3-R 5′ GCAAAAAAACCGTATTCATCC 3′ 14126-14146
G-F 5′ CAGCCAGGCAATCACACAACAGTTC 3′ 5881-5904 G
G-R 5′ CCACTTTCGAAGTGTTATCCTTTTT 3′ 8076-8099
  1. aPrimers according to available subgroup C aMPV Colorado strain, GenBank accession number: AY590688.