Skip to main content

Table 1 Primer and probe sequences used in this study

From: Amino acid changes in the spike protein of feline coronavirus correlate with systemic spread of virus from the intestine and not with feline infectious peritonitis

Name Use Sequence (5’- 3’) Position in FCoV (strain 79-11461) genome Position in FCoV (strain C1Je2) genome
P009 qPCR forward primer AGCAACTACTGCCACRGGAT 26655..26674  
P010 qPCR reverse primer GGAAGGTTCATCTCCCCAGT 26826..26807  
Taqman-P1 FCoV qPCR fluorescent probe FAM-AATGGCCACACAGGGA 26781..26802  
CAACGC-BHQ-1
F614 Forward pyrosequencing primer GCHCARTATTAYAATGGCAT   23436..23460
AATGG
R766 Biotinylated reverse pyrosequencing primer BIO-AAGYCTRGCYTGYACT   23588..23568
TGCAT
S680 Pyrosequencing primer ACAGCCTCDTTAATAGGVGG   23502..23524
ATG
C4 Positive control oligonucleotide GTAAAGCCRTAGGAGATCGA Primer does not target FCoV sequence Primer does not target FCoV sequence
CATGTAGTTACACTGATGAG
TCGATCTCC
  1. 1Accession number DQ010921.
  2. 2Accession number DQ848678.