Skip to main content

Table 2 PCR primer pairs and reaction conditions used in the work described in this paper

From: Early changes in cytokine expression in peste des petits ruminants disease

Target Primer sequences Ta1 [Primer]2 Reference
IL-1β CCTTGGGTATCAGGGACAA 60 200 nM This paper
  GGGTATGGCTTTCTTTAGG    
IL-4 ACCTGTTCTGTGAATGAAGCCAA 61 300 nM This paper
  CTTCATAATAGTCTTTAGCCTTTC    
IL-6 TCCAGAACGAGTTTGAGG 60 400 nM [18]
  CATCCGAATAGCTCTCAG    
IL-8 ATGAGTACAGAACTTCGA 52 300 nM [18]
  TCATGGATCTTGCTTCTC    
IL-10 TGCTGTTGACCCAGTCTCTG 60 200 nM [17]
  AGGGCAGAAAACGATGACAG    
IL-12A GGGCATTGTCTGGCTTCTG 60 200 nM This paper
  TTCTTCCAGGGAGGGTTTCT    
IL-12B GCTGGGAGTACCCTGACACG 63 200 nM [19]
  GTGACTTTGGCTGAGGTTTGGTC    
IL-18 ACTGTTCAGATAATGCACCCCAG 60 300 nM [19]
  TTCTTACACTGCACAGAGATGGTTAC    
Interferon β CCAGATGGTTCTCCTGCTGTGT 60 300 nM [17]
  GACCAATACGGCATCTTCCTTC    
TNFα GGAATACCTGGACTATGCTGA 60 300 nM This paper
  CCTCACTTCCCTACATCCCT    
TGFβ GGACATTAACGGGTTCAGTTC 57 200 nM This paper
  GTCCAGGCTCCAGATGTAAG    
Interferon γ CTCCGGCCTAACTCTCTCCT 60 300 nM [17]
  AGGCCCACCCTTAGCTACAT    
GAPDH GGTGATGCTGGTGCTGAGTA 60 300 nM [18]
  TCATAAGTCCCTCCACGATG    
SDHA ACCTGATGCTTTGTGCTCTGC 60 200 nM [18]
  CCTGGACGGGCTTGGAGTAA    
G6PDH CGAGGCTGTGTACACCAAGA 60 300 nM [17]
  ATGTGGTGGAGCAGTGGAGT    
  1. 1Ta: annealing temperature.
  2. 2[Primer]: primer concentration.