Skip to main content

Table 1 Primers used in this study

From: Autophagic response in the Rabbit Hemorrhagic Disease, an animal model of virally-induced fulminant hepatic failure

Gene Sense primer (5′-3′) Antisense primer (5′-3′) Accession number Fwd start Rev start
Beclin-1 CATGCAATGGTGGCTTTCC TCTCGCCCTTTTCAACCTCTT XM_002719409.1 936 994
UVRAG GCGGCGTCTTCGACATCT GATGGCCGTTTCTATTAACAATGTT XM_002708684.1 117 178
Atg5 CGTCCTGTGGCTGCAGATG AAGGACACACTTCTTTGAGGAGATC XM_002714882 417 479
Atg12 TGCTGAAGGCTGTGGGAGAT TGTTCGCTCTACAGCCCATTT XM_002712042.1 176 237
Atg16L1 CCACCAAACCGGCATGAG CTTGCAGCTGGCTGTCATTC XM_002721435.1 190 250
p62/SQSTM1 AACAGAGGTGACCACCCTTCA AGCACAGACTGGCTGGAAGTC XM_002710315.1 738 798
RHDV TAGCCCAACAGAAGCACAAG AAACAAGTCGTCAACCTCCC    
BiP ATTGACAATGGTGTCTTCGAAGTC CCCCGCCCAGGTGAGT XM_002720437.1 709 766
CHOP ATACATCACCACACCTGAAAGCA GCACTCGGCTGCCATCTC XM_002720915.1 103 160
GRP94 TGCTTAATTGGATGAAAGACAAA GCTGAGACACCACAGCCTTTT XM_002711230.1 1772 1834
β−Actin TGGCATCCTGACGCTCAA TCGTCCCAGTTGGTCACGAT NM_001101683 262 317